EMAIL THIS PAGE TO A FRIEND

KIR3DL2

killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2

23 Gene Product Result for
Synonyms: CD158K NKAT-4 NKAT4 NKAT4B p140
Gene ID:
Human(3812) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the 'framework' loci that is present on all haplotypes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
Mouse(245615) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
cow(537065) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301750 ANTI-KIR3DL2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006737 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220641 MISSION® esiRNA esiRNA targeting human KIR3DL2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006737 Rosetta Predictions human pricing
NM_177748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146346 predicted 604
2 SASI_Hs01_00146354 predicted 1433
3 SASI_Hs01_00146355 predicted 607
4 SASI_Hs02_00342181 predicted 1172
5 SASI_Hs02_00342182 predicted 429
6 SASI_Hs01_00146347 predicted 224
7 SASI_Hs01_00146348 predicted 208
8 SASI_Hs01_00146349 predicted 1411
9 SASI_Hs01_00146350 predicted 569
10 SASI_Hs01_00146351 predicted 208
11 SASI_Hs01_00146352 predicted 504
12 SASI_Hs01_00146353 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118044 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177748
KIR3DL2 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1151s1c1
Sequence:CCGGCAATAAACAGACAGCTTTCTACTCGAGTAGAAAGCTGTCTGTTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-306s1c1
Sequence:CCGGGCTAATGTATTGTCAGCACATCTCGAGATGTGCTGACAATACATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1015s1c1
Sequence:CCGGGCATTCTAACTGGGCTCTTAACTCGAGTTAAGAGCCCAGTTAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-972s1c1
Sequence:CCGGTGCACAGAAGAAGATCCCAAACTCGAGTTTGGGATCTTCTTCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-369s1c1
Sequence:CCGGCCTTTCCTCTTGATTCTACAACTCGAGTTGTAGAATCAAGAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177748
KIR3DL2 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1151s1c1
Sequence:CCGGCAATAAACAGACAGCTTTCTACTCGAGTAGAAAGCTGTCTGTTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-306s1c1
Sequence:CCGGGCTAATGTATTGTCAGCACATCTCGAGATGTGCTGACAATACATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1015s1c1
Sequence:CCGGGCATTCTAACTGGGCTCTTAACTCGAGTTAAGAGCCCAGTTAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-972s1c1
Sequence:CCGGTGCACAGAAGAAGATCCCAAACTCGAGTTTGGGATCTTCTTCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-369s1c1
Sequence:CCGGCCTTTCCTCTTGATTCTACAACTCGAGTTGTAGAATCAAGAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177748
KIR3DL2 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1151s1c1
Sequence:CCGGCAATAAACAGACAGCTTTCTACTCGAGTAGAAAGCTGTCTGTTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-306s1c1
Sequence:CCGGGCTAATGTATTGTCAGCACATCTCGAGATGTGCTGACAATACATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-1015s1c1
Sequence:CCGGGCATTCTAACTGGGCTCTTAACTCGAGTTAAGAGCCCAGTTAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-972s1c1
Sequence:CCGGTGCACAGAAGAAGATCCCAAACTCGAGTTTGGGATCTTCTTCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177748.2-369s1c1
Sequence:CCGGCCTTTCCTCTTGATTCTACAACTCGAGTTGTAGAATCAAGAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006737
KIR3DL2 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-570s1c1
Sequence:CCGGGCAGGAACCTACAGATGTTATCTCGAGATAACATCTGTAGGTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1265s1c1
Sequence:CCGGCCTAACAGATACCAGCGTGTACTCGAGTACACGCTGGTATCTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1064s1c1
Sequence:CCGGCCTCCTCTTCTTTCTCCTTTACTCGAGTAAAGGAGAAAGAAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-444s1c1
Sequence:CCGGGTCATGTTTGAGCACTTCTTTCTCGAGAAAGAAGTGCTCAAACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-135s1c1
Sequence:CCGGGTGGCTCTTCAGTGTCACTATCTCGAGATAGTGACACTGAAGAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006737
KIR3DL2 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-570s1c1
Sequence:CCGGGCAGGAACCTACAGATGTTATCTCGAGATAACATCTGTAGGTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1265s1c1
Sequence:CCGGCCTAACAGATACCAGCGTGTACTCGAGTACACGCTGGTATCTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1064s1c1
Sequence:CCGGCCTCCTCTTCTTTCTCCTTTACTCGAGTAAAGGAGAAAGAAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-444s1c1
Sequence:CCGGGTCATGTTTGAGCACTTCTTTCTCGAGAAAGAAGTGCTCAAACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-135s1c1
Sequence:CCGGGTGGCTCTTCAGTGTCACTATCTCGAGATAGTGACACTGAAGAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006737
KIR3DL2 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-570s1c1
Sequence:CCGGGCAGGAACCTACAGATGTTATCTCGAGATAACATCTGTAGGTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1265s1c1
Sequence:CCGGCCTAACAGATACCAGCGTGTACTCGAGTACACGCTGGTATCTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-1064s1c1
Sequence:CCGGCCTCCTCTTCTTTCTCCTTTACTCGAGTAAAGGAGAAAGAAGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-444s1c1
Sequence:CCGGGTCATGTTTGAGCACTTCTTTCTCGAGAAAGAAGTGCTCAAACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006737.1-135s1c1
Sequence:CCGGGTGGCTCTTCAGTGTCACTATCTCGAGATAGTGACACTGAAGAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)