EMAIL THIS PAGE TO A FRIEND

KIR3DL3

killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3

19 Gene Product Result for
Synonyms: CD158Z KIR3DL7 KIR44 KIRC1
Gene ID:
Human(100133046) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the 'framework' loci that is present on all haplotypes. [provided by RefSeq, Jul 2008]
Human(115653) killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301117 ANTI-KIR3DL3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153443 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180155 predicted 286
2 SASI_Hs01_00180156 predicted 1228
3 SASI_Hs01_00180157 predicted 752
4 SASI_Hs01_00180158 predicted 609
5 SASI_Hs01_00180159 predicted 757
6 SASI_Hs01_00180161 predicted 142
7 SASI_Hs01_00180162 predicted 1237
8 SASI_Hs02_00367279 predicted 764
9 SASI_Hs02_00367280 predicted 245
10 SASI_Hs02_00367281 predicted 234
11 SASI_Hs01_00180160 predicted 1153
12 SASI_Hs01_00180163 predicted 1149
13 SASI_Hs01_00180164 predicted 190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153443
KIR3DL3 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-139s1c1
Sequence:CCGGGAAGGACAACATGTGACTCTTCTCGAGAAGAGTCACATGTTGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-756s1c1
Sequence:CCGGCCGGAGCTTGTTTGACATTTACTCGAGTAAATGTCAAACAAGCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-825s1c1
Sequence:CCGGGCTGAGGGTCAATGGAACATTCTCGAGAATGTTCCATTGACCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-667s1c1
Sequence:CCGGGTCGTAGGTCTATATGGGAAACTCGAGTTTCCCATATAGACCTACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-610s1c1
Sequence:CCGGTCTGTCACTCACTTACCCTATCTCGAGATAGGGTAAGTGAGTGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-1241s21c1
Sequence:CCGGCCAGCGTGTAACACGGAACTTCTCGAGAAGTTCCGTGTTACACGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-226s21c1
Sequence:CCGGGAGCTCTACAACAGAATATTCCTCGAGGAATATTCTGTTGTAGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153443
KIR3DL3 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-139s1c1
Sequence:CCGGGAAGGACAACATGTGACTCTTCTCGAGAAGAGTCACATGTTGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-756s1c1
Sequence:CCGGCCGGAGCTTGTTTGACATTTACTCGAGTAAATGTCAAACAAGCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-825s1c1
Sequence:CCGGGCTGAGGGTCAATGGAACATTCTCGAGAATGTTCCATTGACCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-667s1c1
Sequence:CCGGGTCGTAGGTCTATATGGGAAACTCGAGTTTCCCATATAGACCTACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-610s1c1
Sequence:CCGGTCTGTCACTCACTTACCCTATCTCGAGATAGGGTAAGTGAGTGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-1241s21c1
Sequence:CCGGCCAGCGTGTAACACGGAACTTCTCGAGAAGTTCCGTGTTACACGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-226s21c1
Sequence:CCGGGAGCTCTACAACAGAATATTCCTCGAGGAATATTCTGTTGTAGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153443
KIR3DL3 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-139s1c1
Sequence:CCGGGAAGGACAACATGTGACTCTTCTCGAGAAGAGTCACATGTTGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-756s1c1
Sequence:CCGGCCGGAGCTTGTTTGACATTTACTCGAGTAAATGTCAAACAAGCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-825s1c1
Sequence:CCGGGCTGAGGGTCAATGGAACATTCTCGAGAATGTTCCATTGACCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-667s1c1
Sequence:CCGGGTCGTAGGTCTATATGGGAAACTCGAGTTTCCCATATAGACCTACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153443.2-610s1c1
Sequence:CCGGTCTGTCACTCACTTACCCTATCTCGAGATAGGGTAAGTGAGTGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-1241s21c1
Sequence:CCGGCCAGCGTGTAACACGGAACTTCTCGAGAAGTTCCGTGTTACACGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153443.3-226s21c1
Sequence:CCGGGAGCTCTACAACAGAATATTCCTCGAGGAATATTCTGTTGTAGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)