EMAIL THIS PAGE TO A FRIEND

KIR3DS1

killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1

4 Gene Product Result for
Synonyms: CD158E2 KIR-123FM KIR-G1 NKAT10
UniProtKB ID: Q14943
Gene ID:
Human(3813) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
cow(493736) killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001083539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001083539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001083539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001083539
KIR3DS1 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-653s21c1
Sequence:CCGGCATCGTGGTCACAGGTCTATACTCGAGTATAGACCTGTGACCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-758s21c1
Sequence:CCGGCTATGACATGTACCATCTATCCTCGAGGATAGATGGTACATGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-152s21c1
Sequence:CCGGTCGGTGTCACTATCGTCATAGCTCGAGCTATGACGATAGTGACACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083539.1-1192s21c1
Sequence:CCGGGGAGGTGTCATACGCATAATTCTCGAGAATTATGCGTATGACACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-1152s21c1
Sequence:CCGGCAGAAGTGAACAGCGAGGATTCTCGAGAATCCTCGCTGTTCACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001083539
KIR3DS1 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-653s21c1
Sequence:CCGGCATCGTGGTCACAGGTCTATACTCGAGTATAGACCTGTGACCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-758s21c1
Sequence:CCGGCTATGACATGTACCATCTATCCTCGAGGATAGATGGTACATGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-152s21c1
Sequence:CCGGTCGGTGTCACTATCGTCATAGCTCGAGCTATGACGATAGTGACACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083539.1-1192s21c1
Sequence:CCGGGGAGGTGTCATACGCATAATTCTCGAGAATTATGCGTATGACACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-1152s21c1
Sequence:CCGGCAGAAGTGAACAGCGAGGATTCTCGAGAATCCTCGCTGTTCACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001083539
KIR3DS1 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-653s21c1
Sequence:CCGGCATCGTGGTCACAGGTCTATACTCGAGTATAGACCTGTGACCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-758s21c1
Sequence:CCGGCTATGACATGTACCATCTATCCTCGAGGATAGATGGTACATGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-152s21c1
Sequence:CCGGTCGGTGTCACTATCGTCATAGCTCGAGCTATGACGATAGTGACACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001083539.1-1192s21c1
Sequence:CCGGGGAGGTGTCATACGCATAATTCTCGAGAATTATGCGTATGACACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001083539.1-1152s21c1
Sequence:CCGGCAGAAGTGAACAGCGAGGATTCTCGAGAATCCTCGCTGTTCACTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)