EMAIL THIS PAGE TO A FRIEND

KIR3DX1

killer cell immunoglobulin-like receptor, three domains, X1

29 Gene Product Result for
Synonyms: KIR3DL0 LENG12
UniProtKB ID: Q9H7L2, B7WNL0, Q8N0S4
Gene ID:
Horse(100054868) killer cell immunoglobulin-like receptor, three domains, X1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033206 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126741 MISSION® esiRNA esiRNA human KIR3DX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001047605 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311507 predicted 219
2 SASI_Hs02_00311508 predicted 502
3 SASI_Hs02_00311509 predicted 921
4 SASI_Hs02_00311510 predicted 739
5 SASI_Hs02_00311511 predicted 933
6 SASI_Hs02_00311512 predicted 1058
7 SASI_Hs02_00311513 predicted 1080
8 SASI_Hs02_00311514 predicted 340
9 SASI_Hs02_00311515 predicted 882
10 SASI_Hs02_00311516 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033206
KIR3DX1 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, three domains, X1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-329s1c1
Sequence:CCGGGAAGAGACACAGGAGATCATACTCGAGTATGATCTCCTGTGTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033206.1-1201s1c1
Sequence:CCGGGCGTAGTATTCCGTGGTGTATCTCGAGATACACCACGGAATACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-430s1c1
Sequence:CCGGTCCTAGTATCTACATCACTGTCTCGAGACAGTGATGTAGATACTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-341s1c1
Sequence:CCGGGAGATCATATATGCCCAGTTACTCGAGTAACTGGGCATATATGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-423s1c1
Sequence:CCGGCGGAGGATCCTAGTATCTACACTCGAGTGTAGATACTAGGATCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033206
KIR3DX1 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, three domains, X1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-329s1c1
Sequence:CCGGGAAGAGACACAGGAGATCATACTCGAGTATGATCTCCTGTGTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033206.1-1201s1c1
Sequence:CCGGGCGTAGTATTCCGTGGTGTATCTCGAGATACACCACGGAATACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-430s1c1
Sequence:CCGGTCCTAGTATCTACATCACTGTCTCGAGACAGTGATGTAGATACTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-341s1c1
Sequence:CCGGGAGATCATATATGCCCAGTTACTCGAGTAACTGGGCATATATGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-423s1c1
Sequence:CCGGCGGAGGATCCTAGTATCTACACTCGAGTGTAGATACTAGGATCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033206
KIR3DX1 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, three domains, X1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-329s1c1
Sequence:CCGGGAAGAGACACAGGAGATCATACTCGAGTATGATCTCCTGTGTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033206.1-1201s1c1
Sequence:CCGGGCGTAGTATTCCGTGGTGTATCTCGAGATACACCACGGAATACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-430s1c1
Sequence:CCGGTCCTAGTATCTACATCACTGTCTCGAGACAGTGATGTAGATACTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-341s1c1
Sequence:CCGGGAGATCATATATGCCCAGTTACTCGAGTAACTGGGCATATATGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033206.1-423s1c1
Sequence:CCGGCGGAGGATCCTAGTATCTACACTCGAGTGTAGATACTAGGATCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)