EMAIL THIS PAGE TO A FRIEND

KIRREL2

kin of IRRE like 2 (Drosophila)

98 Gene Product Result for
Synonyms: FILTRIN NEPH3 NLG1
Gene ID:
Mouse(243911) kin of IRRE like 2 (Drosophila)
Rat(100359836) kin of IRRE like 2 (Drosophila)
dog(484570) kin of IRRE like 2 (Drosophila)
Horse(100051677) kin of IRRE like 2 (Drosophila)
cow(538843) kin of IRRE like 2 (Drosophila)
domestic cat(101097772) kin of IRRE like 2 (Drosophila)
domestic guinea pig(100725187) kin of IRRE like 2 (Drosophila)
naked mole-rat(101705969) kin of IRRE like 2 (Drosophila)
sheep(101117442) kin of IRRE like 2 (Drosophila)
Domestic Rabbit(100355246) kin of IRRE like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032123 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032123 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032123 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032123 Rosetta Predictions human pricing
NM_199179 Rosetta Predictions human pricing
NM_199180 Rosetta Predictions human pricing
NM_172898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110058 predicted 752
2 SASI_Hs01_00110060 predicted 1763
3 SASI_Hs02_00359330 predicted 2382
4 SASI_Hs01_00110061 predicted 856
5 SASI_Hs02_00359331 predicted 2307
6 SASI_Hs02_00359332 predicted 2256
7 SASI_Hs01_00110062 predicted 1116
8 SASI_Hs01_00110063 predicted 853
9 SASI_Hs01_00110064 predicted 1084
10 SASI_Hs02_00359333 predicted 2254
11 SASI_Hs01_00110059 predicted 888
12 SASI_Hs01_00110065 predicted 1706
13 SASI_Hs01_00110066 predicted 1628
14 SASI_Hs01_00110067 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234201 predicted 605
2 SASI_Hs01_00234203 predicted 1609
3 SASI_Hs02_00372615 predicted 2228
4 SASI_Hs01_00234204 predicted 706
5 SASI_Hs02_00372616 predicted 2160
6 SASI_Hs02_00372617 predicted 2098
7 SASI_Hs01_00234205 predicted 965
8 SASI_Hs01_00234206 predicted 697
9 SASI_Hs01_00234207 predicted 932
10 SASI_Hs02_00372618 predicted 2100
11 SASI_Hs01_00234202 predicted 742
12 SASI_Hs01_00234208 predicted 1550
13 SASI_Hs01_00234209 predicted 1479
14 SASI_Hs01_00234210 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183825 predicted 754
2 SASI_Hs01_00183827 predicted 1762
3 SASI_Hs02_00372619 predicted 2643
4 SASI_Hs01_00183828 predicted 864
5 SASI_Hs02_00372620 predicted 2579
6 SASI_Hs02_00372621 predicted 2520
7 SASI_Hs01_00183829 predicted 1110
8 SASI_Hs01_00183830 predicted 846
9 SASI_Hs01_00183831 predicted 1087
10 SASI_Hs02_00372622 predicted 2520
11 SASI_Hs01_00183826 predicted 892
12 SASI_Hs01_00183832 predicted 1704
13 SASI_Hs01_00183833 predicted 1619
14 SASI_Hs01_00183834 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162935 predicted 1308
2 SASI_Mm01_00162936 predicted 2088
3 SASI_Mm01_00162937 predicted 2046
4 SASI_Mm01_00162938 predicted 2751
5 SASI_Mm01_00162939 predicted 1677
6 SASI_Mm02_00344877 predicted 2572
7 SASI_Mm01_00162941 predicted 1306
8 SASI_Mm01_00162943 predicted 2547
9 SASI_Mm01_00162944 predicted 2795
10 SASI_Mm02_00344878 predicted 2285
11 SASI_Mm01_00162940 predicted 2764
12 SASI_Mm01_00162942 predicted 2050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032123
KIRREL2 MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-463s21c1
Sequence:CCGGGCCAGCATGACCTCCACATTACTCGAGTAATGTGGAGGTCATGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-2058s21c1
Sequence:CCGGGACTCACGTGTGACATCTTTCCTCGAGGAAAGATGTCACACGTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2185s21c1
Sequence:CCGGGAGGGAAAGATCATTACATTTCTCGAGAAATGTAATGATCTTTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2259s21c1
Sequence:CCGGAGCAACATGGCCACCCAATATCTCGAGATATTGGGTGGCCATGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1590s1c1
Sequence:CCGGCCTGATCTCTGTGCTACACATCTCGAGATGTGTAGCACAGAGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-842s1c1
Sequence:CCGGGAGACACAGCTATCACACTGACTCGAGTCAGTGTGATAGCTGTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1626s1c1
Sequence:CCGGGTCTGACTTTAGCAGGAGCTTCTCGAGAAGCTCCTGCTAAAGTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1628s1c1
Sequence:CCGGCTGACTTTAGCAGGAGCTTTACTCGAGTAAAGCTCCTGCTAAAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1591s1c1
Sequence:CCGGCTGATCTCTGTGCTACACATTCTCGAGAATGTGTAGCACAGAGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032123
KIRREL2 MISSION shRNA shRNA Plasmid DNA
kin of IRRE like 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-463s21c1
Sequence:CCGGGCCAGCATGACCTCCACATTACTCGAGTAATGTGGAGGTCATGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-2058s21c1
Sequence:CCGGGACTCACGTGTGACATCTTTCCTCGAGGAAAGATGTCACACGTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2185s21c1
Sequence:CCGGGAGGGAAAGATCATTACATTTCTCGAGAAATGTAATGATCTTTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2259s21c1
Sequence:CCGGAGCAACATGGCCACCCAATATCTCGAGATATTGGGTGGCCATGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1590s1c1
Sequence:CCGGCCTGATCTCTGTGCTACACATCTCGAGATGTGTAGCACAGAGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-842s1c1
Sequence:CCGGGAGACACAGCTATCACACTGACTCGAGTCAGTGTGATAGCTGTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1626s1c1
Sequence:CCGGGTCTGACTTTAGCAGGAGCTTCTCGAGAAGCTCCTGCTAAAGTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1628s1c1
Sequence:CCGGCTGACTTTAGCAGGAGCTTTACTCGAGTAAAGCTCCTGCTAAAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1591s1c1
Sequence:CCGGCTGATCTCTGTGCTACACATTCTCGAGAATGTGTAGCACAGAGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032123
KIRREL2 MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-463s21c1
Sequence:CCGGGCCAGCATGACCTCCACATTACTCGAGTAATGTGGAGGTCATGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032123.5-2058s21c1
Sequence:CCGGGACTCACGTGTGACATCTTTCCTCGAGGAAAGATGTCACACGTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2185s21c1
Sequence:CCGGGAGGGAAAGATCATTACATTTCTCGAGAAATGTAATGATCTTTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032123.5-2259s21c1
Sequence:CCGGAGCAACATGGCCACCCAATATCTCGAGATATTGGGTGGCCATGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1590s1c1
Sequence:CCGGCCTGATCTCTGTGCTACACATCTCGAGATGTGTAGCACAGAGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-842s1c1
Sequence:CCGGGAGACACAGCTATCACACTGACTCGAGTCAGTGTGATAGCTGTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1626s1c1
Sequence:CCGGGTCTGACTTTAGCAGGAGCTTCTCGAGAAGCTCCTGCTAAAGTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1628s1c1
Sequence:CCGGCTGACTTTAGCAGGAGCTTTACTCGAGTAAAGCTCCTGCTAAAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032123.4-1591s1c1
Sequence:CCGGCTGATCTCTGTGCTACACATTCTCGAGAATGTGTAGCACAGAGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172898
KIRREL2 MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172898.1-2876s1c1
Sequence:CCGGCTGAACATTGAAGGAGGGAAACTCGAGTTTCCCTCCTTCAATGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2050s1c1
Sequence:CCGGCCTTATTTCTGTGCTACACATCTCGAGATGTGTAGCACAGAAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2551s1c1
Sequence:CCGGTCCTACTTACTATGACTTCAACTCGAGTTGAAGTCATAGTAAGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2548s1c1
Sequence:CCGGGACTCCTACTTACTATGACTTCTCGAGAAGTCATAGTAAGTAGGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2045s1c1
Sequence:CCGGCCTGGCCTTATTTCTGTGCTACTCGAGTAGCACAGAAATAAGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172898
KIRREL2 MISSION shRNA shRNA Plasmid DNA
kin of IRRE like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172898.1-2876s1c1
Sequence:CCGGCTGAACATTGAAGGAGGGAAACTCGAGTTTCCCTCCTTCAATGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2050s1c1
Sequence:CCGGCCTTATTTCTGTGCTACACATCTCGAGATGTGTAGCACAGAAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2551s1c1
Sequence:CCGGTCCTACTTACTATGACTTCAACTCGAGTTGAAGTCATAGTAAGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2548s1c1
Sequence:CCGGGACTCCTACTTACTATGACTTCTCGAGAAGTCATAGTAAGTAGGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2045s1c1
Sequence:CCGGCCTGGCCTTATTTCTGTGCTACTCGAGTAGCACAGAAATAAGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172898
KIRREL2 MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172898.1-2876s1c1
Sequence:CCGGCTGAACATTGAAGGAGGGAAACTCGAGTTTCCCTCCTTCAATGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2050s1c1
Sequence:CCGGCCTTATTTCTGTGCTACACATCTCGAGATGTGTAGCACAGAAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2551s1c1
Sequence:CCGGTCCTACTTACTATGACTTCAACTCGAGTTGAAGTCATAGTAAGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2548s1c1
Sequence:CCGGGACTCCTACTTACTATGACTTCTCGAGAAGTCATAGTAAGTAGGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172898.1-2045s1c1
Sequence:CCGGCCTGGCCTTATTTCTGTGCTACTCGAGTAGCACAGAAATAAGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)