EMAIL THIS PAGE TO A FRIEND

KIRREL3-AS3

KIRREL3 antisense RNA 3

83 Gene Product Result for
Synonyms: NCRNA00288 PRR10
Species: Human KIRREL3-AS3(283165)
UniProtKB ID: Q8N7Y1, Q14CX1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173579 Rosetta Predictions human pricing
XR_039964 Rosetta Predictions human pricing
XR_039965 Rosetta Predictions human pricing
XR_039966 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223243 predicted 1158
2 SASI_Hs01_00223244 predicted 1288
3 SASI_Hs01_00223245 predicted 1275
4 SASI_Hs01_00223246 predicted 1141
5 SASI_Hs01_00223247 predicted 1288
6 SASI_Hs01_00223248 predicted 1138
7 SASI_Hs01_00223249 predicted 807
8 SASI_Hs01_00223250 predicted 1305
9 SASI_Hs01_00223251 predicted 1315
10 SASI_Hs01_00223252 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514671 predicted 1153
2 SASI_Hs02_00514672 predicted 1270
3 SASI_Hs02_00514673 predicted 1278
4 SASI_Hs02_00514674 predicted 1140
5 SASI_Hs02_00514675 predicted 1279
6 SASI_Hs02_00514676 predicted 1131
7 SASI_Hs02_00514677 predicted 793
8 SASI_Hs02_00514678 predicted 1300
9 SASI_Hs02_00514679 predicted 443
10 SASI_Hs02_00514680 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514681 predicted 243
2 SASI_Hs02_00514682 predicted 214
3 SASI_Hs02_00514683 predicted 216
4 SASI_Hs02_00514684 predicted 443
5 SASI_Hs02_00514685 predicted 336
6 SASI_Hs02_00514686 predicted 302
7 SASI_Hs02_00514687 predicted 304
8 SASI_Hs02_00514688 predicted 294
9 SASI_Hs02_00514689 predicted 467
10 SASI_Hs02_00514690 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514691 predicted 241
2 SASI_Hs02_00514692 predicted 219
3 SASI_Hs02_00514693 predicted 213
4 SASI_Hs02_00514694 predicted 446
5 SASI_Hs02_00514695 predicted 338
6 SASI_Hs02_00514696 predicted 299
7 SASI_Hs02_00514697 predicted 298
8 SASI_Hs02_00514698 predicted 293
9 SASI_Hs02_00514699 predicted 469
10 SASI_Hs02_00514700 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173579
KIRREL3-AS3 MISSION shRNA Bacterial Glycerol Stock
KIRREL3 antisense RNA 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000005584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173579.1-1284s1c1
Sequence:CCGGCCCAATGTCTATCATGTGTTACTCGAGTAACACATGATAGACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-1138s1c1
Sequence:CCGGGACGAAGAGAGTGATGTGCAACTCGAGTTGCACATCACTCTCTTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-805s1c1
Sequence:CCGGGCATCCTCTCCAGCGTTTCTTCTCGAGAAGAAACGCTGGAGAGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-697s1c1
Sequence:CCGGCGAAAGCCAGCAACTTGGAAACTCGAGTTTCCAAGTTGCTGGCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173579
KIRREL3-AS3 MISSION shRNA shRNA Plasmid DNA
KIRREL3 antisense RNA 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000005584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173579.1-1284s1c1
Sequence:CCGGCCCAATGTCTATCATGTGTTACTCGAGTAACACATGATAGACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-1138s1c1
Sequence:CCGGGACGAAGAGAGTGATGTGCAACTCGAGTTGCACATCACTCTCTTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-805s1c1
Sequence:CCGGGCATCCTCTCCAGCGTTTCTTCTCGAGAAGAAACGCTGGAGAGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-697s1c1
Sequence:CCGGCGAAAGCCAGCAACTTGGAAACTCGAGTTTCCAAGTTGCTGGCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173579
KIRREL3-AS3 MISSION shRNA Lentiviral Transduction Particles
KIRREL3 antisense RNA 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000005584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173579.1-1284s1c1
Sequence:CCGGCCCAATGTCTATCATGTGTTACTCGAGTAACACATGATAGACATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-1138s1c1
Sequence:CCGGGACGAAGAGAGTGATGTGCAACTCGAGTTGCACATCACTCTCTTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-805s1c1
Sequence:CCGGGCATCCTCTCCAGCGTTTCTTCTCGAGAAGAAACGCTGGAGAGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173579.1-697s1c1
Sequence:CCGGCGAAAGCCAGCAACTTGGAAACTCGAGTTTCCAAGTTGCTGGCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)