EMAIL THIS PAGE TO A FRIEND

KIRREL3

kin of IRRE like 3 (Drosophila)

54 Gene Product Result for
Synonyms: KIRRE MRD4 NEPH2 PRO4502
UniProtKB ID: Q8IZU9, Q3MIJ7, Q6UWJ9, Q6UWL5, Q96JG0
Gene ID:
Human(84623) Summary: The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in this gene are associated with mental retardation autosomal dominant type 4 (MRD4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(67703) kin of IRRE like 3 (Drosophila)
Rat(315546) kin of IRRE like 3 (Drosophila)
sheep(101114734) kin of IRRE like 3 (Drosophila)
domestic guinea pig(100717107) kin of IRRE like 3 (Drosophila)
naked mole-rat(101716804) kin of IRRE like 3 (Drosophila)
Zebrafish(572369) kin of IRRE like 3 (Drosophila)
cow(618028) kin of IRRE like 3 (Drosophila)
Horse(100072467) kin of IRRE like 3 (Drosophila)
domestic cat(101089714) kin of IRRE like 3 (Drosophila)
dog(489289) kin of IRRE like 3 (Drosophila)
chicken(419719) kin of IRRE like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1542 Human KIRREL3 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032531 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068141 MISSION® esiRNA esiRNA targeting mouse Kirrel3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032531 Rosetta Predictions human pricing
NM_001048215 Rosetta Predictions rat pricing
NM_026324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360038 predicted 949
2 SASI_Hs01_00070933 predicted 295
3 SASI_Hs01_00070934 predicted 1204
4 SASI_Hs02_00360039 predicted 2095
5 SASI_Hs01_00070935 predicted 1606
6 SASI_Hs01_00070936 predicted 1875
7 SASI_Hs01_00070937 predicted 210
8 SASI_Hs01_00070938 predicted 1619
9 SASI_Hs01_00070939 predicted 987
10 SASI_Hs01_00070940 predicted 1814
11 SASI_Hs01_00070941 predicted 317
12 SASI_Hs01_00070942 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207412 predicted 1065
2 SASI_Rn02_00207413 predicted 1757
3 SASI_Rn02_00207414 predicted 1643
4 SASI_Rn02_00207415 predicted 1775
5 SASI_Rn02_00207416 predicted 1821
6 SASI_Rn02_00207417 predicted 2057
7 SASI_Rn02_00207418 predicted 2373
8 SASI_Rn02_00207419 predicted 1449
9 SASI_Rn02_00207420 predicted 1226
10 SASI_Rn02_00207421 predicted 2190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068003 predicted 1811
2 SASI_Mm01_00068004 predicted 1826
3 SASI_Mm01_00068005 predicted 2716
4 SASI_Mm01_00068006 predicted 369
5 SASI_Mm01_00068007 predicted 1879
6 SASI_Mm01_00068008 predicted 1835
7 SASI_Mm02_00330030 predicted 1237
8 SASI_Mm01_00068009 predicted 1891
9 SASI_Mm01_00068010 predicted 983
10 SASI_Mm01_00068011 predicted 2446
11 SASI_Mm01_00068012 predicted 2268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026324
KIRREL3 MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-922s1c1
Sequence:CCGGGCTACGTAAAGGAGAGGTCATCTCGAGATGACCTCTCCTTTACGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026324.1-3428s1c1
Sequence:CCGGCCACAGCACAATCGAGCTAATCTCGAGATTAGCTCGATTGTGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-491s1c1
Sequence:CCGGCGGAGAATGAATGAAGGTCAACTCGAGTTGACCTTCATTCATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-728s1c1
Sequence:CCGGCTTCAGGATGATGCCGTGTATCTCGAGATACACGGCATCATCCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-1851s1c1
Sequence:CCGGTCCAGACCATATACAACTGTACTCGAGTACAGTTGTATATGGTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026324
KIRREL3 MISSION shRNA shRNA Plasmid DNA
kin of IRRE like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-922s1c1
Sequence:CCGGGCTACGTAAAGGAGAGGTCATCTCGAGATGACCTCTCCTTTACGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026324.1-3428s1c1
Sequence:CCGGCCACAGCACAATCGAGCTAATCTCGAGATTAGCTCGATTGTGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-491s1c1
Sequence:CCGGCGGAGAATGAATGAAGGTCAACTCGAGTTGACCTTCATTCATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-728s1c1
Sequence:CCGGCTTCAGGATGATGCCGTGTATCTCGAGATACACGGCATCATCCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-1851s1c1
Sequence:CCGGTCCAGACCATATACAACTGTACTCGAGTACAGTTGTATATGGTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026324
KIRREL3 MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-922s1c1
Sequence:CCGGGCTACGTAAAGGAGAGGTCATCTCGAGATGACCTCTCCTTTACGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026324.1-3428s1c1
Sequence:CCGGCCACAGCACAATCGAGCTAATCTCGAGATTAGCTCGATTGTGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-491s1c1
Sequence:CCGGCGGAGAATGAATGAAGGTCAACTCGAGTTGACCTTCATTCATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-728s1c1
Sequence:CCGGCTTCAGGATGATGCCGTGTATCTCGAGATACACGGCATCATCCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026324.1-1851s1c1
Sequence:CCGGTCCAGACCATATACAACTGTACTCGAGTACAGTTGTATATGGTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032531
VALIDATED
KIRREL3 MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like 3 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-276s1c1
Sequence:CCGGCCTCTCAAGTTACCCACAGTACTCGAGTACTGTGGGTAACTTGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-118s1c1
Sequence:CCGGCGGAGAATGAATGAAGGCCAACTCGAGTTGGCCTTCATTCATTCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1903s21c1
Sequence:CCGGCAAGGAGCAAGGTTCGGAAATCTCGAGATTTCCGAACCTTGCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-1473s1c1
Sequence:CCGGCGACTTCCAGACCATCTACAACTCGAGTTGTAGATGGTCTGGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-537s1c1
Sequence:CCGGCTCCATCATCTGGTTGCGAAACTCGAGTTTCGCAACCAGATGATGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-547s21c1
Sequence:CCGGACAGCCAGTGACGCTACTTTGCTCGAGCAAAGTAGCGTCACTGGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-1683s1c1
Sequence:CCGGCCGTTCCCAGAGAAATCTCAACTCGAGTTGAGATTTCTCTGGGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1148s21c1
Sequence:CCGGGAGGACAACGTCGTCACTTTCCTCGAGGAAAGTGACGACGTTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032531
VALIDATED
KIRREL3 MISSION shRNA shRNA Plasmid DNA
kin of IRRE like 3 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-276s1c1
Sequence:CCGGCCTCTCAAGTTACCCACAGTACTCGAGTACTGTGGGTAACTTGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-118s1c1
Sequence:CCGGCGGAGAATGAATGAAGGCCAACTCGAGTTGGCCTTCATTCATTCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1903s21c1
Sequence:CCGGCAAGGAGCAAGGTTCGGAAATCTCGAGATTTCCGAACCTTGCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-1473s1c1
Sequence:CCGGCGACTTCCAGACCATCTACAACTCGAGTTGTAGATGGTCTGGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-537s1c1
Sequence:CCGGCTCCATCATCTGGTTGCGAAACTCGAGTTTCGCAACCAGATGATGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-547s21c1
Sequence:CCGGACAGCCAGTGACGCTACTTTGCTCGAGCAAAGTAGCGTCACTGGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-1683s1c1
Sequence:CCGGCCGTTCCCAGAGAAATCTCAACTCGAGTTGAGATTTCTCTGGGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1148s21c1
Sequence:CCGGGAGGACAACGTCGTCACTTTCCTCGAGGAAAGTGACGACGTTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032531
VALIDATED
KIRREL3 MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like 3 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-276s1c1
Sequence:CCGGCCTCTCAAGTTACCCACAGTACTCGAGTACTGTGGGTAACTTGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-118s1c1
Sequence:CCGGCGGAGAATGAATGAAGGCCAACTCGAGTTGGCCTTCATTCATTCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1903s21c1
Sequence:CCGGCAAGGAGCAAGGTTCGGAAATCTCGAGATTTCCGAACCTTGCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032531.1-1473s1c1
Sequence:CCGGCGACTTCCAGACCATCTACAACTCGAGTTGTAGATGGTCTGGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-537s1c1
Sequence:CCGGCTCCATCATCTGGTTGCGAAACTCGAGTTTCGCAACCAGATGATGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-547s21c1
Sequence:CCGGACAGCCAGTGACGCTACTTTGCTCGAGCAAAGTAGCGTCACTGGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_032531.1-1683s1c1
Sequence:CCGGCCGTTCCCAGAGAAATCTCAACTCGAGTTGAGATTTCTCTGGGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032531.3-1148s21c1
Sequence:CCGGGAGGACAACGTCGTCACTTTCCTCGAGGAAAGTGACGACGTTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)