EMAIL THIS PAGE TO A FRIEND

KIRREL

kin of IRRE like (Drosophila)

95 Gene Product Result for
Synonyms: NEPH1
Gene ID:
Human(55243) Summary: NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]
Mouse(170643) kin of IRRE like (Drosophila)
Rat(310695) kin of IRRE like (Drosophila)
chicken(425302) kin of IRRE like (Drosophila)
cow(781667) kin of IRRE like (Drosophila)
domestic cat(101101030) kin of IRRE like (Drosophila)
dog(488606) kin of IRRE like (Drosophila)
sheep(101113647) kin of IRRE like (Drosophila)
Domestic Rabbit(100356636) kin of IRRE like (Drosophila)
domestic guinea pig(100730536) kin of IRRE like (Drosophila)
naked mole-rat(101707154) kin of IRRE like (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018240 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086591 MISSION® esiRNA esiRNA targeting mouse Kirrel (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018240 Rosetta Predictions human pricing
NM_207606 Rosetta Predictions rat pricing
NM_130867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108756 predicted 2034
2 SASI_Hs02_00351582 predicted 819
3 SASI_Hs01_00108757 predicted 1788
4 SASI_Hs01_00108758 predicted 1352
5 SASI_Hs02_00351583 predicted 1118
6 SASI_Hs02_00351584 predicted 971
7 SASI_Hs01_00108759 predicted 1875
8 SASI_Hs01_00108760 predicted 2104
9 SASI_Hs01_00108761 predicted 661
10 SASI_Hs01_00108762 predicted 1752
11 SASI_Hs01_00108763 predicted 918
12 SASI_Hs01_00108764 predicted 921
13 SASI_Hs01_00108765 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056374 predicted 735
2 SASI_Rn01_00056375 predicted 1208
3 SASI_Rn01_00056376 predicted 1897
4 SASI_Rn01_00056377 predicted 1132
5 SASI_Rn01_00056378 predicted 1734
6 SASI_Rn01_00056379 predicted 2026
7 SASI_Rn01_00056381 predicted 678
8 SASI_Rn01_00056382 predicted 1120
9 SASI_Rn01_00056383 predicted 1947
10 SASI_Rn02_00270434 predicted 1191
11 SASI_Rn01_00056380 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079909 predicted 681
2 SASI_Mm01_00079910 predicted 2319
3 SASI_Mm01_00079911 predicted 1131
4 SASI_Mm01_00079912 predicted 1013
5 SASI_Mm01_00079913 predicted 1560
6 SASI_Mm01_00079914 predicted 1115
7 SASI_Mm01_00079915 predicted 1263
8 SASI_Mm01_00079916 predicted 1799
9 SASI_Mm01_00079917 predicted 1045
10 SASI_Mm01_00079918 predicted 1729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130867
KIRREL MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130867.2-2427s1c1
Sequence:CCGGTCCCTGACATTCAGGGACATTCTCGAGAATGTCCCTGAATGTCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-94s1c1
Sequence:CCGGCCACACTTAGTCGTTGCTTATCTCGAGATAAGCAACGACTAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1019s1c1
Sequence:CCGGCCCGGATTGTAGTTTACCCAACTCGAGTTGGGTAAACTACAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1897s1c1
Sequence:CCGGCCCACCAATGGTTATTACAATCTCGAGATTGTAATAACCATTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1461s1c1
Sequence:CCGGGCTCACCATTAATAATGTCATCTCGAGATGACATTATTAATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130867
KIRREL MISSION shRNA shRNA Plasmid DNA
kin of IRRE like (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130867.2-2427s1c1
Sequence:CCGGTCCCTGACATTCAGGGACATTCTCGAGAATGTCCCTGAATGTCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-94s1c1
Sequence:CCGGCCACACTTAGTCGTTGCTTATCTCGAGATAAGCAACGACTAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1019s1c1
Sequence:CCGGCCCGGATTGTAGTTTACCCAACTCGAGTTGGGTAAACTACAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1897s1c1
Sequence:CCGGCCCACCAATGGTTATTACAATCTCGAGATTGTAATAACCATTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1461s1c1
Sequence:CCGGGCTCACCATTAATAATGTCATCTCGAGATGACATTATTAATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130867
KIRREL MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130867.2-2427s1c1
Sequence:CCGGTCCCTGACATTCAGGGACATTCTCGAGAATGTCCCTGAATGTCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-94s1c1
Sequence:CCGGCCACACTTAGTCGTTGCTTATCTCGAGATAAGCAACGACTAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1019s1c1
Sequence:CCGGCCCGGATTGTAGTTTACCCAACTCGAGTTGGGTAAACTACAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1897s1c1
Sequence:CCGGCCCACCAATGGTTATTACAATCTCGAGATTGTAATAACCATTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130867.2-1461s1c1
Sequence:CCGGGCTCACCATTAATAATGTCATCTCGAGATGACATTATTAATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018240
KIRREL MISSION shRNA Bacterial Glycerol Stock
kin of IRRE like (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1626s1c1
Sequence:CCGGCATCTTCTTCTTCATCGCCTTCTCGAGAAGGCGATGAAGAAGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-911s1c1
Sequence:CCGGGCTATGAGACAAATGTGGATTCTCGAGAATCCACATTTGTCTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1491s1c1
Sequence:CCGGCGACTTTCAGACTCACTACAACTCGAGTTGTAGTGAGTCTGAAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-2151s1c1
Sequence:CCGGCGAGAACTATGAGAAGTTCAACTCGAGTTGAACTTCTCATAGTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2030s21c1
Sequence:CCGGAGTGAACCGAGAGCCACTTACCTCGAGGTAAGTGGCTCTCGGTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1765s21c1
Sequence:CCGGCCACGCTCACCATCAACAATGCTCGAGCATTGTTGATGGTGAGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2111s21c1
Sequence:CCGGGGCCATCTACTCGTCGTTTAACTCGAGTTAAACGACGAGTAGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1111s21c1
Sequence:CCGGAGGGTGAGCGTGTTGTCTTTACTCGAGTAAAGACAACACGCTCACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018240
KIRREL MISSION shRNA shRNA Plasmid DNA
kin of IRRE like (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1626s1c1
Sequence:CCGGCATCTTCTTCTTCATCGCCTTCTCGAGAAGGCGATGAAGAAGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-911s1c1
Sequence:CCGGGCTATGAGACAAATGTGGATTCTCGAGAATCCACATTTGTCTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1491s1c1
Sequence:CCGGCGACTTTCAGACTCACTACAACTCGAGTTGTAGTGAGTCTGAAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-2151s1c1
Sequence:CCGGCGAGAACTATGAGAAGTTCAACTCGAGTTGAACTTCTCATAGTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2030s21c1
Sequence:CCGGAGTGAACCGAGAGCCACTTACCTCGAGGTAAGTGGCTCTCGGTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1765s21c1
Sequence:CCGGCCACGCTCACCATCAACAATGCTCGAGCATTGTTGATGGTGAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2111s21c1
Sequence:CCGGGGCCATCTACTCGTCGTTTAACTCGAGTTAAACGACGAGTAGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1111s21c1
Sequence:CCGGAGGGTGAGCGTGTTGTCTTTACTCGAGTAAAGACAACACGCTCACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018240
KIRREL MISSION shRNA Lentiviral Transduction Particles
kin of IRRE like (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1626s1c1
Sequence:CCGGCATCTTCTTCTTCATCGCCTTCTCGAGAAGGCGATGAAGAAGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-911s1c1
Sequence:CCGGGCTATGAGACAAATGTGGATTCTCGAGAATCCACATTTGTCTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-1491s1c1
Sequence:CCGGCGACTTTCAGACTCACTACAACTCGAGTTGTAGTGAGTCTGAAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018240.3-2151s1c1
Sequence:CCGGCGAGAACTATGAGAAGTTCAACTCGAGTTGAACTTCTCATAGTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2030s21c1
Sequence:CCGGAGTGAACCGAGAGCCACTTACCTCGAGGTAAGTGGCTCTCGGTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1765s21c1
Sequence:CCGGCCACGCTCACCATCAACAATGCTCGAGCATTGTTGATGGTGAGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-2111s21c1
Sequence:CCGGGGCCATCTACTCGTCGTTTAACTCGAGTTAAACGACGAGTAGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018240.5-1111s21c1
Sequence:CCGGAGGGTGAGCGTGTTGTCTTTACTCGAGTAAAGACAACACGCTCACCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)