EMAIL THIS PAGE TO A FRIEND

KISS1

KiSS-1 metastasis-suppressor

44 Gene Product Result for
Synonyms: HH13 KiSS-1
UniProtKB ID: Q15726, A8K6N0, Q9HBP1
Gene ID:
Human(3814) Summary: This gene is a metastasis suppressor gene that suppresses metastases of melanomas and breast carcinomas without affecting tumorigenicity. The encoded protein may inhibit chemotaxis and invasion and thereby attenuate metastasis in malignant melanomas. Studies suggest a putative role in the regulation of events downstream of cell-matrix adhesion, perhaps involving cytoskeletal reorganization. A protein product of this gene, kisspeptin, stimulates gonadotropin-releasing hormone (GnRH)-induced gonadotropin secretion and regulates the pubertal activation of GnRH nuerons. A polymorphism in the terminal exon of this mRNA results in two protein isoforms. An adenosine present at the polymorphic site represents the third position in a stop codon. When the adenosine is absent, a downstream stop codon is utilized and the encoded protein extends for an additional seven amino acid residues. [provided by RefSeq, Mar 2012]
Mouse(280287) KiSS-1 metastasis-suppressor
Rat(289023) KiSS-1 metastasis-suppressor
Goat(100860861) KiSS-1 metastasis-suppressor
sheep(101107719) KiSS-1 metastasis-suppressor
sheep(100294562) KiSS-1 metastasis-suppressor
domestic guinea pig(100720081) KiSS-1 metastasis-suppressor
Zebrafish(100134982) KiSS-1 metastasis-suppressor
domestic cat(101083480) KiSS-1 metastasis-suppressor
cow(615613) KiSS-1 metastasis-suppressor
Horse(100054297) KiSS-1 metastasis-suppressor
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002256 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002256 Rosetta Predictions human pricing
NM_181692 Rosetta Predictions rat pricing
NM_178260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217769 predicted 241
2 SASI_Hs01_00217770 predicted 296
3 SASI_Hs01_00217771 predicted 301
4 SASI_Hs01_00217772 predicted 250
5 SASI_Hs01_00217773 predicted 262
6 SASI_Hs01_00217774 predicted 253
7 SASI_Hs01_00217776 predicted 155
8 SASI_Hs02_00333511 predicted 161
9 SASI_Hs02_00333512 predicted 159
10 SASI_Hs01_00217775 predicted 473
11 SASI_Hs01_00217777 predicted 671
12 SASI_Hs01_00217778 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269785 predicted 321
2 SASI_Rn01_00069954 predicted 126
3 SASI_Rn01_00069955 predicted 73
4 SASI_Rn01_00069956 predicted 305
5 SASI_Rn01_00069957 predicted 83
6 SASI_Rn01_00069958 predicted 287
7 SASI_Rn01_00069959 predicted 206
8 SASI_Rn01_00069960 predicted 74
9 SASI_Rn01_00069961 predicted 177
10 SASI_Rn02_00269786 predicted 76
11 SASI_Rn01_00069953 predicted 154
12 SASI_Rn01_00069962 predicted 154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133212 predicted 209
2 SASI_Mm01_00133213 predicted 227
3 SASI_Mm01_00133221 predicted 272
4 SASI_Mm01_00133214 predicted 194
5 SASI_Mm01_00133216 predicted 455
6 SASI_Mm02_00348687 predicted 447
7 SASI_Mm01_00133218 predicted 143
8 SASI_Mm02_00348688 predicted 177
9 SASI_Mm02_00348689 predicted 441
10 SASI_Mm01_00133220 predicted 344
11 SASI_Mm01_00133215 predicted 203
12 SASI_Mm01_00133217 predicted 358
13 SASI_Mm01_00133219 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178260
KISS1 MISSION shRNA Bacterial Glycerol Stock
KiSS-1 metastasis-suppressor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-111s1c1
Sequence:CCGGGTGGCACCTTTGGTGAAGCCTCTCGAGAGGCTTCACCAAAGGTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-229s1c1
Sequence:CCGGGCGCTCGTAGGTCGTCGCCATCTCGAGATGGCGACGACCTACGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-350s1c1
Sequence:CCGGGAAGGACCTGTCGACCTACAACTCGAGTTGTAGGTCGACAGGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-72s1c1
Sequence:CCGGCTCCTCTGTGTCGCCACCTATCTCGAGATAGGTGGCGACACAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-162s1c1
Sequence:CCGGGAACTCGTTAATGCCTGGGAACTCGAGTTCCCAGGCATTAACGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178260
KISS1 MISSION shRNA shRNA Plasmid DNA
KiSS-1 metastasis-suppressor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-111s1c1
Sequence:CCGGGTGGCACCTTTGGTGAAGCCTCTCGAGAGGCTTCACCAAAGGTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-229s1c1
Sequence:CCGGGCGCTCGTAGGTCGTCGCCATCTCGAGATGGCGACGACCTACGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-350s1c1
Sequence:CCGGGAAGGACCTGTCGACCTACAACTCGAGTTGTAGGTCGACAGGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-72s1c1
Sequence:CCGGCTCCTCTGTGTCGCCACCTATCTCGAGATAGGTGGCGACACAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-162s1c1
Sequence:CCGGGAACTCGTTAATGCCTGGGAACTCGAGTTCCCAGGCATTAACGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178260
KISS1 MISSION shRNA Lentiviral Transduction Particles
KiSS-1 metastasis-suppressor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-111s1c1
Sequence:CCGGGTGGCACCTTTGGTGAAGCCTCTCGAGAGGCTTCACCAAAGGTGCCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-229s1c1
Sequence:CCGGGCGCTCGTAGGTCGTCGCCATCTCGAGATGGCGACGACCTACGAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-350s1c1
Sequence:CCGGGAAGGACCTGTCGACCTACAACTCGAGTTGTAGGTCGACAGGTCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-72s1c1
Sequence:CCGGCTCCTCTGTGTCGCCACCTATCTCGAGATAGGTGGCGACACAGAGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178260.2-162s1c1
Sequence:CCGGGAACTCGTTAATGCCTGGGAACTCGAGTTCCCAGGCATTAACGAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002256
KISS1 MISSION shRNA Bacterial Glycerol Stock
KiSS-1 metastasis-suppressor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-189s21c1
Sequence:CCGGTCCTCTGTGCCACCCACTTTGCTCGAGCAAAGTGGGTGGCACAGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-257s1c1
Sequence:CCGGGCAGCTAGAATCCCTGGGCCTCTCGAGAGGCCCAGGGATTCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-473s1c1
Sequence:CCGGCCTGCCGAACTACAACTGGAACTCGAGTTCCAGTTGTAGTTCGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-479s1c1
Sequence:CCGGGAACTACAACTGGAACTCCTTCTCGAGAAGGAGTTCCAGTTGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-461s1c1
Sequence:CCGGGCGGGAGAAGGACCTGCCGAACTCGAGTTCGGCAGGTCCTTCTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-310s1c1
Sequence:CCGGCCGAGAGGAAGCCAGCTGCTACTCGAGTAGCAGCTGGCTTCCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-244s21c1
Sequence:CCGGTTCTAGACCCACAGGCCAGCACTCGAGTGCTGGCCTGTGGGTCTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-534s21c1
Sequence:CCGGCACCAGGGAACCACGGCAGAACTCGAGTTCTGCCGTGGTTCCCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-503s21c1
Sequence:CCGGTTCGGCCTGCGCTTCGGCAAGCTCGAGCTTGCCGAAGCGCAGGCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002256
KISS1 MISSION shRNA shRNA Plasmid DNA
KiSS-1 metastasis-suppressor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-189s21c1
Sequence:CCGGTCCTCTGTGCCACCCACTTTGCTCGAGCAAAGTGGGTGGCACAGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-257s1c1
Sequence:CCGGGCAGCTAGAATCCCTGGGCCTCTCGAGAGGCCCAGGGATTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-473s1c1
Sequence:CCGGCCTGCCGAACTACAACTGGAACTCGAGTTCCAGTTGTAGTTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-479s1c1
Sequence:CCGGGAACTACAACTGGAACTCCTTCTCGAGAAGGAGTTCCAGTTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-461s1c1
Sequence:CCGGGCGGGAGAAGGACCTGCCGAACTCGAGTTCGGCAGGTCCTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-310s1c1
Sequence:CCGGCCGAGAGGAAGCCAGCTGCTACTCGAGTAGCAGCTGGCTTCCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-244s21c1
Sequence:CCGGTTCTAGACCCACAGGCCAGCACTCGAGTGCTGGCCTGTGGGTCTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-534s21c1
Sequence:CCGGCACCAGGGAACCACGGCAGAACTCGAGTTCTGCCGTGGTTCCCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-503s21c1
Sequence:CCGGTTCGGCCTGCGCTTCGGCAAGCTCGAGCTTGCCGAAGCGCAGGCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002256
KISS1 MISSION shRNA Lentiviral Transduction Particles
KiSS-1 metastasis-suppressor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-189s21c1
Sequence:CCGGTCCTCTGTGCCACCCACTTTGCTCGAGCAAAGTGGGTGGCACAGAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-257s1c1
Sequence:CCGGGCAGCTAGAATCCCTGGGCCTCTCGAGAGGCCCAGGGATTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-473s1c1
Sequence:CCGGCCTGCCGAACTACAACTGGAACTCGAGTTCCAGTTGTAGTTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-479s1c1
Sequence:CCGGGAACTACAACTGGAACTCCTTCTCGAGAAGGAGTTCCAGTTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-461s1c1
Sequence:CCGGGCGGGAGAAGGACCTGCCGAACTCGAGTTCGGCAGGTCCTTCTCCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002256.2-310s1c1
Sequence:CCGGCCGAGAGGAAGCCAGCTGCTACTCGAGTAGCAGCTGGCTTCCTCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-244s21c1
Sequence:CCGGTTCTAGACCCACAGGCCAGCACTCGAGTGCTGGCCTGTGGGTCTAGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-534s21c1
Sequence:CCGGCACCAGGGAACCACGGCAGAACTCGAGTTCTGCCGTGGTTCCCTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002256.3-503s21c1
Sequence:CCGGTTCGGCCTGCGCTTCGGCAAGCTCGAGCTTGCCGAAGCGCAGGCCGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)