EMAIL THIS PAGE TO A FRIEND

KISS1R

KISS1 receptor

50 Gene Product Result for
Synonyms: AXOR12 CPPB1 GPR54 HH8 HOT7T175 KISS-1R
UniProtKB ID: Q969F8, A5D8U2, B2RTV1, Q96QG0
Gene ID:
Human(84634) Summary: The protein encoded by this gene is a galanin-like G protein-coupled receptor that binds metastin, a peptide encoded by the metastasis suppressor gene KISS1. The tissue distribution of the expressed gene suggests that it is involved in the regulation of endocrine function, and this is supported by the finding that this gene appears to play a role in the onset of puberty. Mutations in this gene have been associated with hypogonadotropic hypogonadism and central precocious puberty. [provided by RefSeq, Jul 2008]
Mouse(114229) KISS1 receptor
Rat(78976) KISS1 receptor
cow(528699) KISS1 receptor
domestic cat(101094241) KISS1 receptor
dog(612374) KISS1 receptor
naked mole-rat(101713680) KISS1 receptor
sheep(100144753) KISS1 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032551 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009131 MISSION® esiRNA esiRNA targeting mouse Kiss1r (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032551 Rosetta Predictions human pricing
NM_023992 Rosetta Predictions rat pricing
NM_053244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119337 predicted 548
2 SASI_Hs01_00119338 predicted 648
3 SASI_Hs01_00119339 predicted 792
4 SASI_Hs01_00119340 predicted 579
5 SASI_Hs01_00119341 predicted 364
6 SASI_Hs01_00119342 predicted 487
7 SASI_Hs01_00119343 predicted 499
8 SASI_Hs01_00119344 predicted 554
9 SASI_Hs01_00119345 predicted 563
10 SASI_Hs01_00119346 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109750 predicted 391
2 SASI_Rn01_00109751 predicted 213
3 SASI_Rn02_00263825 predicted 284
4 SASI_Rn01_00109752 predicted 369
5 SASI_Rn02_00263826 predicted 284
6 SASI_Rn01_00109753 predicted 228
7 SASI_Rn01_00109755 predicted 376
8 SASI_Rn01_00109756 predicted 772
9 SASI_Rn01_00109758 predicted 331
10 SASI_Rn01_00109759 predicted 626
11 SASI_Rn01_00109754 predicted 395
12 SASI_Rn01_00109757 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124597 predicted 1874
2 SASI_Mm01_00124598 predicted 1867
3 SASI_Mm01_00124599 predicted 2106
4 SASI_Mm01_00124600 predicted 1771
5 SASI_Mm01_00124601 predicted 1911
6 SASI_Mm01_00124602 predicted 2093
7 SASI_Mm01_00124603 predicted 1955
8 SASI_Mm01_00124604 predicted 1875
9 SASI_Mm01_00124605 predicted 2070
10 SASI_Mm01_00124606 predicted 2468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053244
KISS1R MISSION shRNA Bacterial Glycerol Stock
KISS1 receptor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-2324s21c1
Sequence:CCGGCAACCTGCTGGCTCTATATCTCTCGAGAGATATAGAGCCAGCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1878s1c1
Sequence:CCGGCGGAAACTCATTGGTCATCTACTCGAGTAGATGACCAATGAGTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1917s1c1
Sequence:CCGGGCACATGCAGACAGTTACCAACTCGAGTTGGTAACTGTCTGCATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-2043s1c1
Sequence:CCGGCATGTGCAAATTCGTCAACTACTCGAGTAGTTGACGAATTTGCACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1923s1c1
Sequence:CCGGGCAGACAGTTACCAACTTCTACTCGAGTAGAAGTTGGTAACTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053244.2-2914s1c1
Sequence:CCGGGTAAAGCATCCCAGGCTGCTTCTCGAGAAGCAGCCTGGGATGCTTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-1964s21c1
Sequence:CCGGAGACGTCACTTTCCTACTGTGCTCGAGCACAGTAGGAAAGTGACGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053244
KISS1R MISSION shRNA shRNA Plasmid DNA
KISS1 receptor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-2324s21c1
Sequence:CCGGCAACCTGCTGGCTCTATATCTCTCGAGAGATATAGAGCCAGCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1878s1c1
Sequence:CCGGCGGAAACTCATTGGTCATCTACTCGAGTAGATGACCAATGAGTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1917s1c1
Sequence:CCGGGCACATGCAGACAGTTACCAACTCGAGTTGGTAACTGTCTGCATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-2043s1c1
Sequence:CCGGCATGTGCAAATTCGTCAACTACTCGAGTAGTTGACGAATTTGCACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1923s1c1
Sequence:CCGGGCAGACAGTTACCAACTTCTACTCGAGTAGAAGTTGGTAACTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053244.2-2914s1c1
Sequence:CCGGGTAAAGCATCCCAGGCTGCTTCTCGAGAAGCAGCCTGGGATGCTTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-1964s21c1
Sequence:CCGGAGACGTCACTTTCCTACTGTGCTCGAGCACAGTAGGAAAGTGACGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053244
KISS1R MISSION shRNA Lentiviral Transduction Particles
KISS1 receptor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-2324s21c1
Sequence:CCGGCAACCTGCTGGCTCTATATCTCTCGAGAGATATAGAGCCAGCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1878s1c1
Sequence:CCGGCGGAAACTCATTGGTCATCTACTCGAGTAGATGACCAATGAGTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1917s1c1
Sequence:CCGGGCACATGCAGACAGTTACCAACTCGAGTTGGTAACTGTCTGCATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-2043s1c1
Sequence:CCGGCATGTGCAAATTCGTCAACTACTCGAGTAGTTGACGAATTTGCACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053244.2-1923s1c1
Sequence:CCGGGCAGACAGTTACCAACTTCTACTCGAGTAGAAGTTGGTAACTGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053244.2-2914s1c1
Sequence:CCGGGTAAAGCATCCCAGGCTGCTTCTCGAGAAGCAGCCTGGGATGCTTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053244.5-1964s21c1
Sequence:CCGGAGACGTCACTTTCCTACTGTGCTCGAGCACAGTAGGAAAGTGACGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032551
KISS1R MISSION shRNA Bacterial Glycerol Stock
KISS1 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032551.4-341s21c1
Sequence:CCGGCTCGCTGGTCATCTACGTCATCTCGAGATGACGTAGATGACCAGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1412s21c1
Sequence:CCGGAGCGGCTATTCTTCTGTTATTCTCGAGAATAACAGAAGAATAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1451s21c1
Sequence:CCGGCAAGATCAACTGTGGAAATATCTCGAGATATTTCCACAGTTGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032551.2-1252s1c1
Sequence:CCGGGCGGCTATTCTTCTGTTATTACTCGAGTAATAACAGAAGAATAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-219s1c1
Sequence:CCGGGCGGACCGTGACCAACTTCTACTCGAGTAGAAGTTGGTCACGGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-342s1c1
Sequence:CCGGGTGCAAGTTCGTCAACTACATCTCGAGATGTAGTTGACGAACTTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-936s1c1
Sequence:CCGGCTACAGCAACTCCGCGCTGAACTCGAGTTCAGCGCGGAGTTGCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-228s1c1
Sequence:CCGGGACCAACTTCTACATCGCCAACTCGAGTTGGCGATGTAGAAGTTGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032551
KISS1R MISSION shRNA shRNA Plasmid DNA
KISS1 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032551.4-341s21c1
Sequence:CCGGCTCGCTGGTCATCTACGTCATCTCGAGATGACGTAGATGACCAGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1412s21c1
Sequence:CCGGAGCGGCTATTCTTCTGTTATTCTCGAGAATAACAGAAGAATAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1451s21c1
Sequence:CCGGCAAGATCAACTGTGGAAATATCTCGAGATATTTCCACAGTTGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032551.2-1252s1c1
Sequence:CCGGGCGGCTATTCTTCTGTTATTACTCGAGTAATAACAGAAGAATAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-219s1c1
Sequence:CCGGGCGGACCGTGACCAACTTCTACTCGAGTAGAAGTTGGTCACGGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-342s1c1
Sequence:CCGGGTGCAAGTTCGTCAACTACATCTCGAGATGTAGTTGACGAACTTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-936s1c1
Sequence:CCGGCTACAGCAACTCCGCGCTGAACTCGAGTTCAGCGCGGAGTTGCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-228s1c1
Sequence:CCGGGACCAACTTCTACATCGCCAACTCGAGTTGGCGATGTAGAAGTTGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032551
KISS1R MISSION shRNA Lentiviral Transduction Particles
KISS1 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032551.4-341s21c1
Sequence:CCGGCTCGCTGGTCATCTACGTCATCTCGAGATGACGTAGATGACCAGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1412s21c1
Sequence:CCGGAGCGGCTATTCTTCTGTTATTCTCGAGAATAACAGAAGAATAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032551.4-1451s21c1
Sequence:CCGGCAAGATCAACTGTGGAAATATCTCGAGATATTTCCACAGTTGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032551.2-1252s1c1
Sequence:CCGGGCGGCTATTCTTCTGTTATTACTCGAGTAATAACAGAAGAATAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-219s1c1
Sequence:CCGGGCGGACCGTGACCAACTTCTACTCGAGTAGAAGTTGGTCACGGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-342s1c1
Sequence:CCGGGTGCAAGTTCGTCAACTACATCTCGAGATGTAGTTGACGAACTTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-936s1c1
Sequence:CCGGCTACAGCAACTCCGCGCTGAACTCGAGTTCAGCGCGGAGTTGCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032551.2-228s1c1
Sequence:CCGGGACCAACTTCTACATCGCCAACTCGAGTTGGCGATGTAGAAGTTGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)