EMAIL THIS PAGE TO A FRIEND

KIT

v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog

246 Gene Product Result for
Synonyms: C-Kit CD117 PBT SCFR
Gene ID:
Human(3815) Summary: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16590) kit oncogene
Rat(64030) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
chicken(378783) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
domestic cat(493766) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
cow(280832) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Horse(100009704) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
dog(403811) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Goat(100861386) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
sheep(780504) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Domestic Rabbit(100327263) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
domestic guinea pig(100726397) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
naked mole-rat(101726400) v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501648 Anti-C-KIT antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB1305105 ANTI-C-KIT(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1305429 ANTI-C-KIT(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human
flow cytometry, immunohistochemistry, western blot pricing
SAB5500036 Anti-CD117/c-kit (SP26), rabbit monoclonal antibody clone SP26, recombinant, expressed in proprietary host, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB4300489 Anti-KIT (Ab-721) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300593 Anti-KIT (Ab-936) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
GW21114 Anti-KIT antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1412042 ANTI-KIT antibody produced in mouse clone 1G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412043 ANTI-KIT antibody produced in mouse clone 5F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412044 ANTI-KIT antibody produced in mouse clone 5A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412045 ANTI-KIT antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412046 ANTI-KIT antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412140 ANTI-KIT antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412141 ANTI-KIT antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA004471 Anti-KIT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4501647 Anti-KIT antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA073252 Anti-KIT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504458 Anti-phospho-c-Kit (pTyr721) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
C6740 Anti-phospho-c-Kit (SCFR) (pTyr703) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
C6615 Anti-phospho-c-Kit (SCFR) (pTyr730) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
C6490 Anti-phospho-c-Kit (SCFR) (pTyr823) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, canine, mouse
western blot pricing
C6365 Anti-phospho-c-Kit (SCFR) (pTyr936) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat, canine
western blot pricing
SAB4503931 Anti-phospho-KIT (pTyr703) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301513 Anti-phospho-KIT (pTyr703) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300191 Anti-phospho-KIT (pTyr721) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300277 Anti-phospho-KIT (pTyr936) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4503930 Anti-phospho-KIT (pTyr936) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
S2562 Anti-Stem Cell Factor Receptor (SCF R) antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
SAB4700750 Monoclonal Anti-CD117 antibody produced in mouse clone 104D2, purified immunoglobulin, buffered aqueous solution nonhuman primates, human, bovine
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP) pricing
SAB4700725 Monoclonal Anti-CD117-APC antibody produced in mouse clone 104D2, purified immunoglobulin, buffered aqueous solution bovine, nonhuman primates, human
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP) pricing
SAB4700711 Monoclonal Anti-CD117-FITC antibody produced in mouse clone 104D2, purified immunoglobulin, buffered aqueous solution human, bovine, nonhuman primates
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP) pricing
SAB4700695 Monoclonal Anti-CD117-PE antibody produced in mouse clone 104D2, purified immunoglobulin, buffered aqueous solution bovine, human, nonhuman primates
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP) pricing
WH0003815M2 Monoclonal Anti-KIT antibody produced in mouse clone 6F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB90901 Monoclonal Anti-KIT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1657, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90904 Monoclonal Anti-KIT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1667, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1404007 Monoclonal Anti-KIT antibody produced in mouse clone 6G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, proximity ligation assay, western blot pricing
SAB5300439 Monoclonal Anti-KIT antibody produced in mouse clone 8D7, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300440 Monoclonal Anti-KIT antibody produced in mouse clone 1C5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
AMAB90900 Monoclonal Anti-KIT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1656, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
C0624 c-KIT (544-end), active, GST tagged human PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥75% (SDS-PAGE), buffered aqueous glycerol solution human pricing
C0499 c-KIT (544-end, V654A), active, GST tagged human PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5299 c-KIT (D820E), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5300 c-KIT (N822K), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5308 c-KIT (T670E), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5309 c-KIT (T670I), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP5310 c-KIT (Y823D), active, GST tagged human PRECISIO®, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution human pricing
SRP0341 cKit active human recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE) human pricing
SRP0342 cKit active human recombinant, expressed in baculovirus infected Sf9 cells, ≥32% (SDS-PAGE) human pricing
SRP0343 cKit active human recombinant, expressed in baculovirus infected Sf9 cells, ≥22% (SDS-PAGE) human pricing
APREST93130 PrEST Antigen KIT Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST86859 PrEST Antigen KIT Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
S2437 SCF Soluble Receptor human >95% (SDS-PAGE), recombinant, expressed in baculovirus infected Sf21 cells, lyophilized powder human pricing
QPREST23016 SILuPrEST KIT SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST23017 SILuPrEST KIT SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST23018 SILuPrEST KIT SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB1164 Anti-c-Kit Antibody, clone 1DC3 This Anti-c-Kit Antibody, clone 1DC3 is validated for use in FC, IH, IP, WB for the detection of c-Kit. pricing
MAB1163 Anti-c-Kit Antibody, clone KIT4 Detect c-Kit using this Anti-c-Kit Antibody, clone KIT4 validated for use in FC, IF & IP. pricing
MAB1162 Anti-c-Kit Antibody, clone YB5.B8 Anti-c-Kit Antibody, clone YB5.B8 detects level of c-Kit & has been published & validated for use in FC, IH & IP. pricing
MAB1162F Anti-c-Kit Antibody, clone YB5.B8, FITC conjugated Anti-c-Kit Antibody, clone YB5.B8, FITC conjugated is an antibody against c-Kit for use in FC. pricing
MAB1162H Anti-c-Kit Antibody, clone YB5.B8, Phycoerythrin conjugated This Anti-c-Kit Antibody, clone YB5.B8, Phycoerythrin conjugated is validated for use in FC for the detection of c-Kit. pricing
CBL1360 Anti-CD117 Antibody, clone ACK2 Detect CD117 using this Anti-CD117 Antibody, clone ACK2 validated for use in FC, IH, IP, FUNC & WB. pricing
MABF2053 Anti-CD117 (c-Kit) Antibody, clone 2C11 This mouse monoclonal Anti-CD117 (c-Kit), clone 2C11 Antibody, Cat. No. MABF2053 is tested for use in Western Blotting and Flow Cytometry, for the detection of C-kit. pricing
MABF360 Anti-CD117 (c-kit) Antibody (mouse), APC, clone ACK2 This rat monoclonal antibody Anti-CD117 (c-kit) (mouse), APC & clone ACK2 validated for use in western blotting;IHC;ICC;Flow Cytometry for the detection of CD117 (c-kit). pricing
MABF510 Anti-CD117 (c-Kit) Antibody (mouse), APC, clone ACK2 This rat monoclonal antibody Anti-CD117 (c-Kit) (mouse), APC, clone ACK2 validated for use in western blotting, IHC, ICC & Flow Cytometry for the detection of CD117 (c-Kit). pricing
MABF361 Anti-CD117 (c-kit) Antibody (mouse), PE, clone ACK2 This rat monoclonal antibody Anti-CD117 (c-kit) (mouse), PE, clone ACK2 validated for use in IHC, ICC & Flow Cytometry for the detection of CD117 (c-kit). pricing
MABF511 Anti-CD117 (c-Kit) Antibody (mouse), PE, clone ACK2 This rat monoclonal antibody Anti-CD117 (c-Kit) (mouse), PE, clone ACK2 validated for use in IHC, ICC & Flow Cytometry for the detection of CD117 (c-Kit). pricing
MABF149D Anti-CD117 (c-Kit) (mouse), PE-Cy7, clone ACK2 Antibody Anti-CD117 (c-Kit) (mouse), PE-Cy7, clone ACK2 Antibody is an antibody against CD117 for use in Flow Cytometry. pricing
07-806 Anti-phospho-c-Kit (Tyr568/Tyr570) Antibody Anti-phospho-c-Kit (Tyr568/Tyr570) Antibody is an antibody against phospho-c-Kit (Tyr568/Tyr570) for use in WB. pricing
07-804 Anti-phospho-c-Kit (Tyr721) Antibody This Anti-phospho-c-Kit (Tyr721) Antibody is validated for use in WB for the detection of phospho-c-Kit (Tyr721). pricing
14-726-M c-Kit (D816H) Protein, active, 10 µg Active, N-terminal GST tagged, recombinant, human c-Kit, amino acids 544-end containing the mutation D816H, for use in Kinase Assays. pricing
14-611-M c-Kit (D816V) Protein, active, 10 µg Active, N-terminal GST tagged, recombinant human c-Kit, amino acids 544-end containing the D816V mutation, for use in Kinase Assays. pricing
14-559-M c-Kit Protein, active, 250 µg Active, N-terminal GST tagged, recombinant, human Kit, amino acids 544-end, for use in Kinase Assays. pricing
14-730-M c-Kit (V560G) Protein, active, 10 µg Active, N-terminal GST tagged recombinant human c-Kit, amino acids 544 -end, containing the V560G mutation, found in patients with gastrointestinal stromal tumours. For use in Kinase Assays. pricing
14-733-M c-Kit (V654A) Protein, active, 10 µg V654A is an acquired resistance mutation found in patients with gastrointestinal stromal tumours (GISTs) undergoing treatment with Imatinib. The V654A mutation is strongly correlated with imatinib resistance & rapid progession of GISTs. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000222 Rosetta Predictions human pricing
NM_001093772 Rosetta Predictions human pricing
NM_022264 Rosetta Predictions rat pricing
NM_001122733 Rosetta Predictions mouse pricing
NM_021099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088058 predicted 2473
2 SASI_Hs01_00088060 predicted 2235
3 SASI_Hs01_00088061 predicted 657
4 SASI_Hs01_00088062 predicted 950
5 SASI_Hs02_00302117 predicted 2917
6 SASI_Hs01_00088063 predicted 1906
7 SASI_Hs01_00088064 predicted 1275
8 SASI_Hs02_00302118 predicted 1968
9 SASI_Hs01_00088065 predicted 1874
10 SASI_Hs02_00302119 predicted 2247
11 SASI_Hs01_00088059 predicted 255
12 SASI_Hs01_00088066 predicted 1415
13 SASI_Hs01_00088067 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318205 predicted 2457
2 SASI_Hs02_00318206 predicted 2215
3 SASI_Hs02_00318207 predicted 659
4 SASI_Hs02_00318208 predicted 949
5 SASI_Hs02_00318209 predicted 2902
6 SASI_Hs02_00318210 predicted 1887
7 SASI_Hs02_00318211 predicted 1278
8 SASI_Hs02_00318212 predicted 1954
9 SASI_Hs02_00318213 predicted 1867
10 SASI_Hs02_00318214 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097877 predicted 2265
2 SASI_Rn01_00097878 predicted 693
3 SASI_Rn01_00097879 predicted 2208
4 SASI_Rn01_00097880 predicted 2428
5 SASI_Rn01_00097881 predicted 2738
6 SASI_Rn01_00097882 predicted 909
7 SASI_Rn02_00263066 predicted 1239
8 SASI_Rn01_00097883 predicted 1985
9 SASI_Rn01_00097884 predicted 2790
10 SASI_Rn01_00097885 predicted 1292
11 SASI_Rn01_00097886 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309274 predicted 2233
2 SASI_Mm02_00309275 predicted 1144
3 SASI_Mm02_00309276 predicted 2276
4 SASI_Mm02_00309277 predicted 642
5 SASI_Mm02_00309278 predicted 933
6 SASI_Mm02_00309279 predicted 2808
7 SASI_Mm02_00309280 predicted 927
8 SASI_Mm02_00309281 predicted 974
9 SASI_Mm02_00309282 predicted 1220
10 SASI_Mm02_00309283 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167380 predicted 2220
2 SASI_Mm01_00167381 predicted 1145
3 SASI_Mm01_00167382 predicted 2255
4 SASI_Mm02_00325791 predicted 629
5 SASI_Mm01_00167385 predicted 931
6 SASI_Mm01_00167386 predicted 2799
7 SASI_Mm02_00325792 predicted 922
8 SASI_Mm01_00167387 predicted 965
9 SASI_Mm01_00167388 predicted 1219
10 SASI_Mm01_00167389 predicted 1279
11 SASI_Mm01_00167383 predicted 2448
12 SASI_Mm01_00167384 predicted 2413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000222
VALIDATED
KIT MISSION shRNA Bacterial Glycerol Stock
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.x-3671s1c1
Sequence:CCGGCCATAAGGTTTCGTTTCTGTACTCGAGTACAGAAACGAAACCTTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-2640s1c1
Sequence:CCGGGCCGGTCGATTCTAAGTTCTACTCGAGTAGAACTTAGAATCGACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-1481s1c1
Sequence:CCGGGCACGGTTGAATGTAAGGCTTCTCGAGAAGCCTTACATTCAACCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-311s1c1
Sequence:CCGGGCACCAACAAACACGGCTTAACTCGAGTTAAGCCGTGTTTGTTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-173s1c1
Sequence:CCGGGCGACGAGATTAGGCTGTTATCTCGAGATAACAGCCTAATCTCGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-915s21c1
Sequence:CCGGTATCAGTTCAGCGAGAGTTAACTCGAGTTAACTCTCGCTGAACTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000222.2-3355s21c1
Sequence:CCGGACCTGAATAAATGGTAGTAATCTCGAGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2942s21c1
Sequence:CCGGACCATTCTGTGCGGATCAATTCTCGAGAATTGATCCGCACAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1838s1c1
Sequence:CCGGCAACTGCTTATGGCTTAATTACTCGAGTAATTAAGCCATAAGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.1-3290s1c1
Sequence:CCGGCCTGAATAAATGGTAGTAATCCTCGAGGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-2018s1c1
Sequence:CCGGCCCTGGTCATTACAGAATATTCTCGAGAATATTCTGTAATGACCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000222.1-4825s1c1
Sequence:CCGGCCTTTGTGTTTCTATTGACTTCTCGAGAAGTCAATAGAAACACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1618s1c1
Sequence:CCGGGCTGGCATGATGTGCATTATTCTCGAGAATAATGCACATCATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-332s1c1
Sequence:CCGGGCAATTCCATTTATGTGTTTGCTCGAGCAAACACATAAATGGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-439s1c1
Sequence:CCGGGACCCAGAAGTGACCAATTATCTCGAGATAATTGGTCACTTCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1119s21c1
Sequence:CCGGACACCAGCAGTGGATCTATATCTCGAGATATAGATCCACTGCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-3791s21c1
Sequence:CCGGAGTAGATTAAGAGCCATATAACTCGAGTTATATGGCTCTTAATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1935s21c1
Sequence:CCGGGGCCATGACTGTCGCTGTAAACTCGAGTTTACAGCGACAGTCATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2366s21c1
Sequence:CCGGACGAGTTGGCCCTAGACTTAGCTCGAGCTAAGTCTAGGGCCAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-1215s21c1
Sequence:CCGGACTTCATCTAACGAGATTAAACTCGAGTTTAATCTCGTTAGATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000222
VALIDATED
KIT MISSION shRNA shRNA Plasmid DNA
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.x-3671s1c1
Sequence:CCGGCCATAAGGTTTCGTTTCTGTACTCGAGTACAGAAACGAAACCTTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-2640s1c1
Sequence:CCGGGCCGGTCGATTCTAAGTTCTACTCGAGTAGAACTTAGAATCGACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-1481s1c1
Sequence:CCGGGCACGGTTGAATGTAAGGCTTCTCGAGAAGCCTTACATTCAACCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-311s1c1
Sequence:CCGGGCACCAACAAACACGGCTTAACTCGAGTTAAGCCGTGTTTGTTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-173s1c1
Sequence:CCGGGCGACGAGATTAGGCTGTTATCTCGAGATAACAGCCTAATCTCGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-915s21c1
Sequence:CCGGTATCAGTTCAGCGAGAGTTAACTCGAGTTAACTCTCGCTGAACTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000222.2-3355s21c1
Sequence:CCGGACCTGAATAAATGGTAGTAATCTCGAGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2942s21c1
Sequence:CCGGACCATTCTGTGCGGATCAATTCTCGAGAATTGATCCGCACAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1838s1c1
Sequence:CCGGCAACTGCTTATGGCTTAATTACTCGAGTAATTAAGCCATAAGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.1-3290s1c1
Sequence:CCGGCCTGAATAAATGGTAGTAATCCTCGAGGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-2018s1c1
Sequence:CCGGCCCTGGTCATTACAGAATATTCTCGAGAATATTCTGTAATGACCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000222.1-4825s1c1
Sequence:CCGGCCTTTGTGTTTCTATTGACTTCTCGAGAAGTCAATAGAAACACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1618s1c1
Sequence:CCGGGCTGGCATGATGTGCATTATTCTCGAGAATAATGCACATCATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-332s1c1
Sequence:CCGGGCAATTCCATTTATGTGTTTGCTCGAGCAAACACATAAATGGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-439s1c1
Sequence:CCGGGACCCAGAAGTGACCAATTATCTCGAGATAATTGGTCACTTCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1119s21c1
Sequence:CCGGACACCAGCAGTGGATCTATATCTCGAGATATAGATCCACTGCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-3791s21c1
Sequence:CCGGAGTAGATTAAGAGCCATATAACTCGAGTTATATGGCTCTTAATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1935s21c1
Sequence:CCGGGGCCATGACTGTCGCTGTAAACTCGAGTTTACAGCGACAGTCATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2366s21c1
Sequence:CCGGACGAGTTGGCCCTAGACTTAGCTCGAGCTAAGTCTAGGGCCAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-1215s21c1
Sequence:CCGGACTTCATCTAACGAGATTAAACTCGAGTTTAATCTCGTTAGATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000222
VALIDATED
KIT MISSION shRNA Lentiviral Transduction Particles
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.x-3671s1c1
Sequence:CCGGCCATAAGGTTTCGTTTCTGTACTCGAGTACAGAAACGAAACCTTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-2640s1c1
Sequence:CCGGGCCGGTCGATTCTAAGTTCTACTCGAGTAGAACTTAGAATCGACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-1481s1c1
Sequence:CCGGGCACGGTTGAATGTAAGGCTTCTCGAGAAGCCTTACATTCAACCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-311s1c1
Sequence:CCGGGCACCAACAAACACGGCTTAACTCGAGTTAAGCCGTGTTTGTTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.x-173s1c1
Sequence:CCGGGCGACGAGATTAGGCTGTTATCTCGAGATAACAGCCTAATCTCGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-915s21c1
Sequence:CCGGTATCAGTTCAGCGAGAGTTAACTCGAGTTAACTCTCGCTGAACTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000222.2-3355s21c1
Sequence:CCGGACCTGAATAAATGGTAGTAATCTCGAGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2942s21c1
Sequence:CCGGACCATTCTGTGCGGATCAATTCTCGAGAATTGATCCGCACAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1838s1c1
Sequence:CCGGCAACTGCTTATGGCTTAATTACTCGAGTAATTAAGCCATAAGCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000222.1-3290s1c1
Sequence:CCGGCCTGAATAAATGGTAGTAATCCTCGAGGATTACTACCATTTATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-2018s1c1
Sequence:CCGGCCCTGGTCATTACAGAATATTCTCGAGAATATTCTGTAATGACCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000222.1-4825s1c1
Sequence:CCGGCCTTTGTGTTTCTATTGACTTCTCGAGAAGTCAATAGAAACACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-1618s1c1
Sequence:CCGGGCTGGCATGATGTGCATTATTCTCGAGAATAATGCACATCATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-332s1c1
Sequence:CCGGGCAATTCCATTTATGTGTTTGCTCGAGCAAACACATAAATGGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000222.1-439s1c1
Sequence:CCGGGACCCAGAAGTGACCAATTATCTCGAGATAATTGGTCACTTCTGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1119s21c1
Sequence:CCGGACACCAGCAGTGGATCTATATCTCGAGATATAGATCCACTGCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-3791s21c1
Sequence:CCGGAGTAGATTAAGAGCCATATAACTCGAGTTATATGGCTCTTAATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000222.2-1935s21c1
Sequence:CCGGGGCCATGACTGTCGCTGTAAACTCGAGTTTACAGCGACAGTCATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-2366s21c1
Sequence:CCGGACGAGTTGGCCCTAGACTTAGCTCGAGCTAAGTCTAGGGCCAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000222.2-1215s21c1
Sequence:CCGGACTTCATCTAACGAGATTAAACTCGAGTTTAATCTCGTTAGATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021099
KIT MISSION shRNA Bacterial Glycerol Stock
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1318s21c1
Sequence:CCGGGACGTACGACAGGCTCATAAACTCGAGTTTATGAGCCTGTCGTACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021099.3-3417s21c1
Sequence:CCGGCCTTAATGATGGGAGATATATCTCGAGATATATCTCCCATCATTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-211s1c1
Sequence:CCGGCGACTTTGTCAGATGGACTTTCTCGAGAAAGTCCATCTGACAAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1101s1c1
Sequence:CCGGCGGCTAACAAAGGGAAGGATTCTCGAGAATCCTTCCCTTTGTTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1742s1c1
Sequence:CCGGCCGACGCAACTTCCTTATGATCTCGAGATCATAAGGAAGTTGCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2432s1c1
Sequence:CCGGCGGATCACAAAGATTTGCGATCTCGAGATCGCAAATCTTTGTGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2246s1c1
Sequence:CCGGGCAAGAATAGACTCGTACATACTCGAGTATGTACGAGTCTATTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-256s21c1
Sequence:CCGGATGGACTTTCAAGACCTATTTCTCGAGAAATAGGTCTTGAAAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1198s21c1
Sequence:CCGGACTTCGCCTGACCAGATTAAACTCGAGTTTAATCTGGTCAGGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021099
KIT MISSION shRNA shRNA Plasmid DNA
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1318s21c1
Sequence:CCGGGACGTACGACAGGCTCATAAACTCGAGTTTATGAGCCTGTCGTACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021099.3-3417s21c1
Sequence:CCGGCCTTAATGATGGGAGATATATCTCGAGATATATCTCCCATCATTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-211s1c1
Sequence:CCGGCGACTTTGTCAGATGGACTTTCTCGAGAAAGTCCATCTGACAAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1101s1c1
Sequence:CCGGCGGCTAACAAAGGGAAGGATTCTCGAGAATCCTTCCCTTTGTTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1742s1c1
Sequence:CCGGCCGACGCAACTTCCTTATGATCTCGAGATCATAAGGAAGTTGCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2432s1c1
Sequence:CCGGCGGATCACAAAGATTTGCGATCTCGAGATCGCAAATCTTTGTGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2246s1c1
Sequence:CCGGGCAAGAATAGACTCGTACATACTCGAGTATGTACGAGTCTATTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-256s21c1
Sequence:CCGGATGGACTTTCAAGACCTATTTCTCGAGAAATAGGTCTTGAAAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1198s21c1
Sequence:CCGGACTTCGCCTGACCAGATTAAACTCGAGTTTAATCTGGTCAGGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021099
KIT MISSION shRNA Lentiviral Transduction Particles
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1318s21c1
Sequence:CCGGGACGTACGACAGGCTCATAAACTCGAGTTTATGAGCCTGTCGTACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021099.3-3417s21c1
Sequence:CCGGCCTTAATGATGGGAGATATATCTCGAGATATATCTCCCATCATTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-211s1c1
Sequence:CCGGCGACTTTGTCAGATGGACTTTCTCGAGAAAGTCCATCTGACAAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1101s1c1
Sequence:CCGGCGGCTAACAAAGGGAAGGATTCTCGAGAATCCTTCCCTTTGTTAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-1742s1c1
Sequence:CCGGCCGACGCAACTTCCTTATGATCTCGAGATCATAAGGAAGTTGCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2432s1c1
Sequence:CCGGCGGATCACAAAGATTTGCGATCTCGAGATCGCAAATCTTTGTGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021099.2-2246s1c1
Sequence:CCGGGCAAGAATAGACTCGTACATACTCGAGTATGTACGAGTCTATTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-256s21c1
Sequence:CCGGATGGACTTTCAAGACCTATTTCTCGAGAAATAGGTCTTGAAAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021099.3-1198s21c1
Sequence:CCGGACTTCGCCTGACCAGATTAAACTCGAGTTTAATCTGGTCAGGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)