EMAIL THIS PAGE TO A FRIEND

KITLG

KIT ligand

83 Gene Product Result for
Synonyms: FPH2 KL-1 Kitl MGF SCF SF SHEP7
Gene ID:
Human(4254) Summary: This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(60427) KIT ligand
Goat(100860807) KIT ligand
sheep(443371) KIT ligand
chicken(396028) KIT ligand
dog(403507) KIT ligand
Horse(100034127) KIT ligand
cow(281885) KIT ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003994 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_000899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000899 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086831 MISSION® esiRNA esiRNA human KITLG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000899 Rosetta Predictions human pricing
NM_003994 Rosetta Predictions human pricing
NM_021843 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091105 predicted 996
2 SASI_Hs01_00091106 predicted 297
3 SASI_Hs02_00303463 predicted 292
4 SASI_Hs01_00091107 predicted 375
5 SASI_Hs01_00091108 predicted 272
6 SASI_Hs02_00303464 predicted 999
7 SASI_Hs01_00091110 predicted 231
8 SASI_Hs01_00091111 predicted 478
9 SASI_Hs02_00303465 predicted 1070
10 SASI_Hs01_00091112 predicted 403
11 SASI_Hs01_00091109 predicted 1006
12 SASI_Hs01_00091113 predicted 473
13 SASI_Hs01_00091114 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058531 predicted 909
2 SASI_Hs01_00058532 predicted 302
3 SASI_Hs02_00336710 predicted 298
4 SASI_Hs01_00058533 predicted 375
5 SASI_Hs01_00058534 predicted 267
6 SASI_Hs02_00336711 predicted 908
7 SASI_Hs01_00058536 predicted 225
8 SASI_Hs01_00058537 predicted 478
9 SASI_Hs02_00336712 predicted 987
10 SASI_Hs01_00058538 predicted 405
11 SASI_Hs01_00058535 predicted 926
12 SASI_Hs01_00058539 predicted 464
13 SASI_Hs01_00058540 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104045 predicted 385
2 SASI_Rn01_00104046 predicted 218
3 SASI_Rn01_00104047 predicted 208
4 SASI_Rn01_00104048 predicted 364
5 SASI_Rn01_00104049 predicted 579
6 SASI_Rn01_00104050 predicted 657
7 SASI_Rn01_00104051 predicted 393
8 SASI_Rn01_00104052 predicted 334
9 SASI_Rn01_00104053 predicted 303
10 SASI_Rn01_00104054 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003994
KITLG MISSION shRNA Bacterial Glycerol Stock
KIT ligand
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-430s1c1
Sequence:CCGGCTTGACTGATCTTCTGGACAACTCGAGTTGTCCAGAAGATCAGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-338s1c1
Sequence:CCGGGACTACATGATAACCCTCAAACTCGAGTTTGAGGGTTATCATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-907s1c1
Sequence:CCGGGAGAGAGTTTCAAGAAGTGTACTCGAGTACACTTCTTGAAACTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-241s1c1
Sequence:CCGGCCTATTTAATCCTCTCGTCAACTCGAGTTGACGAGAGGATTAAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003994.3-986s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-503s1c1
Sequence:CCGGGTGAATATAGTGGATGACCTTCTCGAGAAGGTCATCCACTATATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-235s1c1
Sequence:CCGGGCTGCTCCTATTTAATCCTCTCTCGAGAGAGGATTAAATAGGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-834s1c1
Sequence:CCGGGTCTTACAAGGGCAGTTGAAACTCGAGTTTCAACTGCCCTTGTAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003994
KITLG MISSION shRNA shRNA Plasmid DNA
KIT ligand
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-430s1c1
Sequence:CCGGCTTGACTGATCTTCTGGACAACTCGAGTTGTCCAGAAGATCAGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-338s1c1
Sequence:CCGGGACTACATGATAACCCTCAAACTCGAGTTTGAGGGTTATCATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-907s1c1
Sequence:CCGGGAGAGAGTTTCAAGAAGTGTACTCGAGTACACTTCTTGAAACTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-241s1c1
Sequence:CCGGCCTATTTAATCCTCTCGTCAACTCGAGTTGACGAGAGGATTAAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003994.3-986s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-503s1c1
Sequence:CCGGGTGAATATAGTGGATGACCTTCTCGAGAAGGTCATCCACTATATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-235s1c1
Sequence:CCGGGCTGCTCCTATTTAATCCTCTCTCGAGAGAGGATTAAATAGGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-834s1c1
Sequence:CCGGGTCTTACAAGGGCAGTTGAAACTCGAGTTTCAACTGCCCTTGTAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003994
KITLG MISSION shRNA Lentiviral Transduction Particles
KIT ligand
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-430s1c1
Sequence:CCGGCTTGACTGATCTTCTGGACAACTCGAGTTGTCCAGAAGATCAGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-338s1c1
Sequence:CCGGGACTACATGATAACCCTCAAACTCGAGTTTGAGGGTTATCATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-907s1c1
Sequence:CCGGGAGAGAGTTTCAAGAAGTGTACTCGAGTACACTTCTTGAAACTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-241s1c1
Sequence:CCGGCCTATTTAATCCTCTCGTCAACTCGAGTTGACGAGAGGATTAAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003994.3-986s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-503s1c1
Sequence:CCGGGTGAATATAGTGGATGACCTTCTCGAGAAGGTCATCCACTATATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-235s1c1
Sequence:CCGGGCTGCTCCTATTTAATCCTCTCTCGAGAGAGGATTAAATAGGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003994.3-834s1c1
Sequence:CCGGGTCTTACAAGGGCAGTTGAAACTCGAGTTTCAACTGCCCTTGTAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000899
VALIDATED
KITLG MISSION shRNA Bacterial Glycerol Stock
KIT ligand
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-765s1c1
Sequence:CCGGCCCTTAGGAATGACAGCAGTACTCGAGTACTGCTGTCATTCCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000899.2-914s1c1
Sequence:CCGGCCAAGTCTTACAAGGGCAGTTCTCGAGAACTGCCCTTGTAAGACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000899.2-1070s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000899
VALIDATED
KITLG MISSION shRNA shRNA Plasmid DNA
KIT ligand
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-765s1c1
Sequence:CCGGCCCTTAGGAATGACAGCAGTACTCGAGTACTGCTGTCATTCCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000899.2-914s1c1
Sequence:CCGGCCAAGTCTTACAAGGGCAGTTCTCGAGAACTGCCCTTGTAAGACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000899.2-1070s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000899
VALIDATED
KITLG MISSION shRNA Lentiviral Transduction Particles
KIT ligand
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-765s1c1
Sequence:CCGGCCCTTAGGAATGACAGCAGTACTCGAGTACTGCTGTCATTCCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000899.2-914s1c1
Sequence:CCGGCCAAGTCTTACAAGGGCAGTTCTCGAGAACTGCCCTTGTAAGACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000899.2-1070s1c1
Sequence:CCGGGCTTCATAAATGAAGCAGCTTCTCGAGAAGCTGCTTCATTTATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-307s1c1
Sequence:CCGGCGTCACTAAATTGGTGGCAAACTCGAGTTTGCCACCAATTTAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000899.2-276s1c1
Sequence:CCGGGCAGGAATCGTGTGACTAATACTCGAGTATTAGTCACACGATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)