EMAIL THIS PAGE TO A FRIEND

KL

klotho

151 Gene Product Result for
UniProtKB ID: Q9UEF7, Q5VZ95, Q96KV5, Q96KW5, Q9UEI9, Q9Y4F0
Gene ID:
Human(9365) Summary: This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
Mouse(16591) klotho
Rat(83504) Klotho
cow(784635) klotho
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131091 MISSION® esiRNA esiRNA human KL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004795 Rosetta Predictions human pricing
NM_153683 Rosetta Predictions human pricing
NM_031336 Rosetta Predictions rat pricing
NM_013823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109402 predicted 2709
2 SASI_Hs01_00109403 predicted 1042
3 SASI_Hs01_00109404 predicted 2735
4 SASI_Hs01_00109405 predicted 2389
5 SASI_Hs01_00109406 predicted 975
6 SASI_Hs01_00109407 predicted 966
7 SASI_Hs01_00109408 predicted 1146
8 SASI_Hs02_00338323 predicted 1205
9 SASI_Hs01_00109409 predicted 2069
10 SASI_Hs01_00109410 predicted 2770
11 SASI_Hs01_00109411 predicted 2418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210499 predicted 1050
2 SASI_Hs01_00210500 predicted 984
3 SASI_Hs01_00210501 predicted 972
4 SASI_Hs01_00210502 predicted 1157
5 SASI_Hs01_00210503 predicted 1211
6 SASI_Hs01_00210504 predicted 2127
7 SASI_Hs01_00210505 predicted 918
8 SASI_Hs01_00210506 predicted 1209
9 SASI_Hs01_00210507 predicted 977
10 SASI_Hs01_00210508 predicted 2061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033344 predicted 2812
2 SASI_Rn02_00264568 predicted 1331
3 SASI_Rn01_00033345 predicted 2841
4 SASI_Rn02_00264569 predicted 991
5 SASI_Rn01_00033348 predicted 961
6 SASI_Rn02_00264570 predicted 2715
7 SASI_Rn01_00033349 predicted 1298
8 SASI_Rn01_00033351 predicted 860
9 SASI_Rn01_00033352 predicted 2755
10 SASI_Rn01_00033353 predicted 2368
11 SASI_Rn01_00033346 predicted 1016
12 SASI_Rn01_00033347 predicted 3020
13 SASI_Rn01_00033350 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322794 predicted 3137
2 SASI_Mm02_00322795 predicted 911
3 SASI_Mm02_00322796 predicted 1168
4 SASI_Mm02_00322797 predicted 894
5 SASI_Mm02_00322798 predicted 983
6 SASI_Mm02_00322799 predicted 1612
7 SASI_Mm02_00322800 predicted 2476
8 SASI_Mm02_00322801 predicted 2829
9 SASI_Mm02_00322802 predicted 1514
10 SASI_Mm02_00322803 predicted 2325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004795
KL MISSION shRNA Bacterial Glycerol Stock
klotho
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-901s21c1
Sequence:CCGGTAAGCTCTCACTGGATCAATCCTCGAGGATTGATCCAGTGAGAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004795.3-3426s21c1
Sequence:CCGGTAATTGCAAGAGTTCGAATAGCTCGAGCTATTCGAACTCTTGCAATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2819s1c1
Sequence:CCGGCAAGGCATCCATGAAACATTACTCGAGTAATGTTTCATGGATGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-1587s1c1
Sequence:CCGGGTTGTTGACAACTACATTCAACTCGAGTTGAATGTAGTTGTCAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2339s1c1
Sequence:CCGGGCTGAACCAAAGAAACAATTTCTCGAGAAATTGTTTCTTTGGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-985s21c1
Sequence:CCGGGGTTTGCCAAACCCGTATTTACTCGAGTAAATACGGGTTTGGCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-3749s1c1
Sequence:CCGGGCCTTGCACATAGGAAACTTTCTCGAGAAAGTTTCCTATGTGCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2364s1c1
Sequence:CCGGCTTCCTTATTTCACTGAAGATCTCGAGATCTTCAGTGAAATAAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-4206s1c1
Sequence:CCGGCGCTGAAACATGCTAGTGATACTCGAGTATCACTAGCATGTTTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004795
KL MISSION shRNA shRNA Plasmid DNA
klotho
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-901s21c1
Sequence:CCGGTAAGCTCTCACTGGATCAATCCTCGAGGATTGATCCAGTGAGAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004795.3-3426s21c1
Sequence:CCGGTAATTGCAAGAGTTCGAATAGCTCGAGCTATTCGAACTCTTGCAATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2819s1c1
Sequence:CCGGCAAGGCATCCATGAAACATTACTCGAGTAATGTTTCATGGATGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-1587s1c1
Sequence:CCGGGTTGTTGACAACTACATTCAACTCGAGTTGAATGTAGTTGTCAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2339s1c1
Sequence:CCGGGCTGAACCAAAGAAACAATTTCTCGAGAAATTGTTTCTTTGGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-985s21c1
Sequence:CCGGGGTTTGCCAAACCCGTATTTACTCGAGTAAATACGGGTTTGGCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-3749s1c1
Sequence:CCGGGCCTTGCACATAGGAAACTTTCTCGAGAAAGTTTCCTATGTGCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2364s1c1
Sequence:CCGGCTTCCTTATTTCACTGAAGATCTCGAGATCTTCAGTGAAATAAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-4206s1c1
Sequence:CCGGCGCTGAAACATGCTAGTGATACTCGAGTATCACTAGCATGTTTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004795
KL MISSION shRNA Lentiviral Transduction Particles
klotho
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-901s21c1
Sequence:CCGGTAAGCTCTCACTGGATCAATCCTCGAGGATTGATCCAGTGAGAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004795.3-3426s21c1
Sequence:CCGGTAATTGCAAGAGTTCGAATAGCTCGAGCTATTCGAACTCTTGCAATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2819s1c1
Sequence:CCGGCAAGGCATCCATGAAACATTACTCGAGTAATGTTTCATGGATGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-1587s1c1
Sequence:CCGGGTTGTTGACAACTACATTCAACTCGAGTTGAATGTAGTTGTCAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2339s1c1
Sequence:CCGGGCTGAACCAAAGAAACAATTTCTCGAGAAATTGTTTCTTTGGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004795.3-985s21c1
Sequence:CCGGGGTTTGCCAAACCCGTATTTACTCGAGTAAATACGGGTTTGGCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-3749s1c1
Sequence:CCGGGCCTTGCACATAGGAAACTTTCTCGAGAAAGTTTCCTATGTGCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004795.2-2364s1c1
Sequence:CCGGCTTCCTTATTTCACTGAAGATCTCGAGATCTTCAGTGAAATAAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004795.2-4206s1c1
Sequence:CCGGCGCTGAAACATGCTAGTGATACTCGAGTATCACTAGCATGTTTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013823
KL MISSION shRNA Bacterial Glycerol Stock
klotho
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013823.1-3697s1c1
Sequence:CCGGGCCTGCTTGTTGGAGATTCTTCTCGAGAAGAATCTCCAACAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-661s1c1
Sequence:CCGGGCCGACCATTTCAGGGATTATCTCGAGATAATCCCTGAAATGGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-402s1c1
Sequence:CCGGCGATAGTTACAACAACGTCTACTCGAGTAGACGTTGTTGTAACTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-2818s1c1
Sequence:CCGGGCGAATCAGTTTGAGCCCAAACTCGAGTTTGGGCTCAAACTGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-1168s1c1
Sequence:CCGGCCTAACATGAAGTTCCGCCAACTCGAGTTGGCGGAACTTCATGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013823
KL MISSION shRNA shRNA Plasmid DNA
klotho
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013823.1-3697s1c1
Sequence:CCGGGCCTGCTTGTTGGAGATTCTTCTCGAGAAGAATCTCCAACAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-661s1c1
Sequence:CCGGGCCGACCATTTCAGGGATTATCTCGAGATAATCCCTGAAATGGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-402s1c1
Sequence:CCGGCGATAGTTACAACAACGTCTACTCGAGTAGACGTTGTTGTAACTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-2818s1c1
Sequence:CCGGGCGAATCAGTTTGAGCCCAAACTCGAGTTTGGGCTCAAACTGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-1168s1c1
Sequence:CCGGCCTAACATGAAGTTCCGCCAACTCGAGTTGGCGGAACTTCATGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013823
KL MISSION shRNA Lentiviral Transduction Particles
klotho
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013823.1-3697s1c1
Sequence:CCGGGCCTGCTTGTTGGAGATTCTTCTCGAGAAGAATCTCCAACAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-661s1c1
Sequence:CCGGGCCGACCATTTCAGGGATTATCTCGAGATAATCCCTGAAATGGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-402s1c1
Sequence:CCGGCGATAGTTACAACAACGTCTACTCGAGTAGACGTTGTTGTAACTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-2818s1c1
Sequence:CCGGGCGAATCAGTTTGAGCCCAAACTCGAGTTTGGGCTCAAACTGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013823.1-1168s1c1
Sequence:CCGGCCTAACATGAAGTTCCGCCAACTCGAGTTGGCGGAACTTCATGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)