EMAIL THIS PAGE TO A FRIEND

KLB

klotho beta

59 Gene Product Result for
Synonyms: BKL
UniProtKB ID: Q86Z14, Q2M3K8
Gene ID:
Mouse(83379) klotho beta
Rat(289625) klotho beta
Zebrafish(796269) klotho beta
cow(514925) klotho beta
Horse(100064228) klotho beta
dog(479110) klotho beta
chicken(425467) klotho beta
sheep(101109707) klotho beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108630 Anti-KLB affinity isolated antibody rat, mouse, human, bovine
immunohistochemistry, western blot pricing
AV53325 Anti-KLB antibody produced in rabbit affinity isolated antibody rabbit, horse, rat, human, canine, guinea pig, mouse
western blot pricing
HPA021136 Anti-KLB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175737 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034721 MISSION® esiRNA esiRNA targeting mouse Klb (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175737 Rosetta Predictions human pricing
XM_001078178 Rosetta Predictions rat pricing
XM_223410 Rosetta Predictions rat pricing
NM_031180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083505 predicted 650
2 SASI_Hs01_00083506 predicted 1320
3 SASI_Hs01_00083508 predicted 1421
4 SASI_Hs01_00083509 predicted 577
5 SASI_Hs01_00083510 predicted 927
6 SASI_Hs01_00083511 predicted 682
7 SASI_Hs02_00369081 predicted 2846
8 SASI_Hs02_00369082 predicted 960
9 SASI_Hs01_00083513 predicted 1562
10 SASI_Hs01_00083514 predicted 1586
11 SASI_Hs01_00083507 predicted 324
12 SASI_Hs01_00083512 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359883 predicted 247
2 SASI_Rn02_00359884 predicted 1676
3 SASI_Rn02_00359885 predicted 833
4 SASI_Rn02_00359886 predicted 1719
5 SASI_Rn02_00359887 predicted 661
6 SASI_Rn02_00359888 predicted 611
7 SASI_Rn02_00359889 predicted 585
8 SASI_Rn02_00359890 predicted 1241
9 SASI_Rn02_00359891 predicted 1731
10 SASI_Rn02_00359892 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124840 predicted 1935
2 SASI_Rn01_00124841 predicted 1968
3 SASI_Rn01_00124842 predicted 1989
4 SASI_Rn01_00124843 predicted 1894
5 SASI_Rn01_00124844 predicted 1868
6 SASI_Rn01_00124845 predicted 2000
7 SASI_Rn01_00124846 predicted 1950
8 SASI_Rn01_00124847 predicted 1961
9 SASI_Rn01_00124848 predicted 1706
10 SASI_Rn01_00124849 predicted 1940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111641 predicted 220
2 SASI_Mm01_00111642 predicted 3136
3 SASI_Mm01_00111643 predicted 1223
4 SASI_Mm01_00111644 predicted 2311
5 SASI_Mm01_00111645 predicted 1838
6 SASI_Mm01_00111647 predicted 2087
7 SASI_Mm01_00111648 predicted 1815
8 SASI_Mm02_00337019 predicted 638
9 SASI_Mm01_00111649 predicted 1193
10 SASI_Mm02_00337020 predicted 1307
11 SASI_Mm01_00111640 predicted 376
12 SASI_Mm01_00111646 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031180
KLB MISSION shRNA Bacterial Glycerol Stock
klotho beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2164s1c1
Sequence:CCGGGCACCTCTATGATAGGCAGTACTCGAGTACTGCCTATCATAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-229s1c1
Sequence:CCGGCCTCTATGACACTTTCCCTAACTCGAGTTAGGGAAAGTGTCATAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.2-1845s1c1
Sequence:CCGGGACAAGTGTTAAGGTACTATACTCGAGTATAGTACCTTAACACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2335s1c2
Sequence:CCGGCGACTATCCATCGGTTATGAACTCGAGTTCATAACCGATGGATAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3233s1c1
Sequence:CCGGCCTCTGAAGTGTGGTTCAAATCTCGAGATTTGAACCACACTTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2801s1c1
Sequence:CCGGGAGAAATCTAAGCCTAGATTTCTCGAGAAATCTAGGCTTAGATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2353s1c1
Sequence:CCGGGAAGGAATACATCGCCTCCAACTCGAGTTGGAGGCGATGTATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-169s1c1
Sequence:CCGGCGGGAAAGCAATATGGGATAACTCGAGTTATCCCATATTGCTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3170s1c1
Sequence:CCGGGCTCCATGTACTGGTAACTTACTCGAGTAAGTTACCAGTACATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031180
KLB MISSION shRNA shRNA Plasmid DNA
klotho beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2164s1c1
Sequence:CCGGGCACCTCTATGATAGGCAGTACTCGAGTACTGCCTATCATAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-229s1c1
Sequence:CCGGCCTCTATGACACTTTCCCTAACTCGAGTTAGGGAAAGTGTCATAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.2-1845s1c1
Sequence:CCGGGACAAGTGTTAAGGTACTATACTCGAGTATAGTACCTTAACACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2335s1c2
Sequence:CCGGCGACTATCCATCGGTTATGAACTCGAGTTCATAACCGATGGATAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3233s1c1
Sequence:CCGGCCTCTGAAGTGTGGTTCAAATCTCGAGATTTGAACCACACTTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2801s1c1
Sequence:CCGGGAGAAATCTAAGCCTAGATTTCTCGAGAAATCTAGGCTTAGATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2353s1c1
Sequence:CCGGGAAGGAATACATCGCCTCCAACTCGAGTTGGAGGCGATGTATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-169s1c1
Sequence:CCGGCGGGAAAGCAATATGGGATAACTCGAGTTATCCCATATTGCTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3170s1c1
Sequence:CCGGGCTCCATGTACTGGTAACTTACTCGAGTAAGTTACCAGTACATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031180
KLB MISSION shRNA Lentiviral Transduction Particles
klotho beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2164s1c1
Sequence:CCGGGCACCTCTATGATAGGCAGTACTCGAGTACTGCCTATCATAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-229s1c1
Sequence:CCGGCCTCTATGACACTTTCCCTAACTCGAGTTAGGGAAAGTGTCATAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.2-1845s1c1
Sequence:CCGGGACAAGTGTTAAGGTACTATACTCGAGTATAGTACCTTAACACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2335s1c2
Sequence:CCGGCGACTATCCATCGGTTATGAACTCGAGTTCATAACCGATGGATAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3233s1c1
Sequence:CCGGCCTCTGAAGTGTGGTTCAAATCTCGAGATTTGAACCACACTTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2801s1c1
Sequence:CCGGGAGAAATCTAAGCCTAGATTTCTCGAGAAATCTAGGCTTAGATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-2353s1c1
Sequence:CCGGGAAGGAATACATCGCCTCCAACTCGAGTTGGAGGCGATGTATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031180.1-169s1c1
Sequence:CCGGCGGGAAAGCAATATGGGATAACTCGAGTTATCCCATATTGCTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031180.1-3170s1c1
Sequence:CCGGGCTCCATGTACTGGTAACTTACTCGAGTAAGTTACCAGTACATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175737
KLB MISSION shRNA Bacterial Glycerol Stock
klotho beta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-988s21c1
Sequence:CCGGGATCACGTTGGGATCTCATTGCTCGAGCAATGAGATCCCAACGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-1443s21c1
Sequence:CCCGTAGATGAAATACGAGTGTTTGCTCGAGCAAACACTCGTATTTCATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-3073s1c1
Sequence:CCGGGCAGAAGAAACCACTGATATTCTCGAGAATATCAGTGGTTTCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-414s1c1
Sequence:CCGGGACCTTCTATATGGGATCATTCTCGAGAATGATCCCATATAGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-1328s1c1
Sequence:CCGGCGAATCTTGATTGCTGAGAATCTCGAGATTCTCAGCAATCAAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175737
KLB MISSION shRNA shRNA Plasmid DNA
klotho beta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-988s21c1
Sequence:CCGGGATCACGTTGGGATCTCATTGCTCGAGCAATGAGATCCCAACGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-1443s21c1
Sequence:CCCGTAGATGAAATACGAGTGTTTGCTCGAGCAAACACTCGTATTTCATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-3073s1c1
Sequence:CCGGGCAGAAGAAACCACTGATATTCTCGAGAATATCAGTGGTTTCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-414s1c1
Sequence:CCGGGACCTTCTATATGGGATCATTCTCGAGAATGATCCCATATAGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-1328s1c1
Sequence:CCGGCGAATCTTGATTGCTGAGAATCTCGAGATTCTCAGCAATCAAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175737
KLB MISSION shRNA Lentiviral Transduction Particles
klotho beta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-988s21c1
Sequence:CCGGGATCACGTTGGGATCTCATTGCTCGAGCAATGAGATCCCAACGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175737.3-1443s21c1
Sequence:CCCGTAGATGAAATACGAGTGTTTGCTCGAGCAAACACTCGTATTTCATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-3073s1c1
Sequence:CCGGGCAGAAGAAACCACTGATATTCTCGAGAATATCAGTGGTTTCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-414s1c1
Sequence:CCGGGACCTTCTATATGGGATCATTCTCGAGAATGATCCCATATAGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175737.2-1328s1c1
Sequence:CCGGCGAATCTTGATTGCTGAGAATCTCGAGATTCTCAGCAATCAAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)