EMAIL THIS PAGE TO A FRIEND

KLC1

kinesin light chain 1

176 Gene Product Result for
Synonyms: KLC KNS2 KNS2A
Gene ID:
Human(3831) Summary: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named 'kinesin 2', this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature and/or biological validity of most of these variants have not been determined. [provided by RefSeq, Jul 2008]
Mouse(16593) kinesin light chain 1
Rat(171041) kinesin light chain 1
chicken(423484) kinesin light chain 1
cow(508999) kinesin light chain 1
Horse(100055290) kinesin light chain 1
domestic cat(101099130) kinesin light chain 1
dog(480446) kinesin light chain 1
sheep(101102677) kinesin light chain 1
domestic guinea pig(100736081) kinesin light chain 1
naked mole-rat(101710626) kinesin light chain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077931 MISSION® esiRNA esiRNA targeting mouse Klc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005552 Rosetta Predictions human pricing
NM_182923 Rosetta Predictions human pricing
NM_001081972 Rosetta Predictions rat pricing
NM_001081973 Rosetta Predictions rat pricing
NM_001081974 Rosetta Predictions rat pricing
NM_001025358 Rosetta Predictions mouse pricing
NM_001025359 Rosetta Predictions mouse pricing
NM_001025360 Rosetta Predictions mouse pricing
NM_001025361 Rosetta Predictions mouse pricing
NM_001025362 Rosetta Predictions mouse pricing
NM_001025363 Rosetta Predictions mouse pricing
NM_001081959 Rosetta Predictions mouse pricing
NM_008450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246050 predicted 747
2 SASI_Hs01_00246051 predicted 1120
3 SASI_Hs01_00246053 predicted 564
4 SASI_Hs01_00246054 predicted 1671
5 SASI_Hs01_00246055 predicted 1667
6 SASI_Hs01_00246056 predicted 1549
7 SASI_Hs01_00246057 predicted 1310
8 SASI_Hs02_00339799 predicted 737
9 SASI_Hs01_00246059 predicted 1374
10 SASI_Hs02_00339800 predicted 1194
11 SASI_Hs01_00246052 predicted 1330
12 SASI_Hs01_00246058 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206722 predicted 744
2 SASI_Hs01_00206723 predicted 1111
3 SASI_Hs01_00206725 predicted 566
4 SASI_Hs01_00206726 predicted 1676
5 SASI_Hs01_00206727 predicted 1669
6 SASI_Hs01_00206728 predicted 1547
7 SASI_Hs01_00206729 predicted 1315
8 SASI_Hs02_00371045 predicted 739
9 SASI_Hs01_00206731 predicted 1373
10 SASI_Hs02_00371046 predicted 1200
11 SASI_Hs01_00206724 predicted 1317
12 SASI_Hs01_00206730 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208659 predicted 922
2 SASI_Rn02_00208660 predicted 1119
3 SASI_Rn02_00208661 predicted 1032
4 SASI_Rn02_00208662 predicted 1459
5 SASI_Rn02_00208663 predicted 1428
6 SASI_Rn02_00208664 predicted 1427
7 SASI_Rn02_00208665 predicted 1240
8 SASI_Rn02_00208666 predicted 1011
9 SASI_Rn02_00208667 predicted 267
10 SASI_Rn02_00208668 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208669 predicted 946
2 SASI_Rn02_00208670 predicted 1133
3 SASI_Rn02_00208671 predicted 1050
4 SASI_Rn02_00208672 predicted 1484
5 SASI_Rn02_00208673 predicted 1450
6 SASI_Rn02_00208674 predicted 1442
7 SASI_Rn02_00208675 predicted 1266
8 SASI_Rn02_00208676 predicted 1040
9 SASI_Rn02_00208677 predicted 295
10 SASI_Rn02_00208678 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208679 predicted 932
2 SASI_Rn02_00208680 predicted 1122
3 SASI_Rn02_00208681 predicted 1033
4 SASI_Rn02_00208682 predicted 1470
5 SASI_Rn02_00208683 predicted 1428
6 SASI_Rn02_00208684 predicted 1427
7 SASI_Rn02_00208685 predicted 1249
8 SASI_Rn02_00208686 predicted 1023
9 SASI_Rn02_00208687 predicted 281
10 SASI_Rn02_00208688 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093848 predicted 615
2 SASI_Mm01_00093849 predicted 981
3 SASI_Mm01_00093850 predicted 1425
4 SASI_Mm01_00093851 predicted 911
5 SASI_Mm01_00093852 predicted 1293
6 SASI_Mm01_00093853 predicted 1097
7 SASI_Mm01_00093854 predicted 1437
8 SASI_Mm01_00093855 predicted 1095
9 SASI_Mm01_00093856 predicted 1439
10 SASI_Mm01_00093857 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152114 predicted 621
2 SASI_Mm01_00152115 predicted 978
3 SASI_Mm01_00152116 predicted 1432
4 SASI_Mm01_00152117 predicted 906
5 SASI_Mm01_00152118 predicted 1293
6 SASI_Mm01_00152119 predicted 1093
7 SASI_Mm01_00152120 predicted 1433
8 SASI_Mm01_00152121 predicted 1098
9 SASI_Mm01_00152122 predicted 1439
10 SASI_Mm01_00152123 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034179 predicted 711
2 SASI_Mm01_00034180 predicted 1089
3 SASI_Mm01_00034182 predicted 1008
4 SASI_Mm02_00287840 predicted 254
5 SASI_Mm01_00034183 predicted 1390
6 SASI_Mm01_00034184 predicted 1195
7 SASI_Mm01_00034186 predicted 1194
8 SASI_Mm01_00034188 predicted 1374
9 SASI_Mm02_00287841 predicted 310
10 SASI_Mm02_00287842 predicted 254
11 SASI_Mm01_00034181 predicted 1429
12 SASI_Mm01_00034185 predicted 1433
13 SASI_Mm01_00034187 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075583 predicted 987
2 SASI_Mm01_00075584 predicted 1434
3 SASI_Mm01_00075585 predicted 904
4 SASI_Mm01_00075586 predicted 1293
5 SASI_Mm01_00075587 predicted 1657
6 SASI_Mm01_00075588 predicted 1091
7 SASI_Mm01_00075589 predicted 1429
8 SASI_Mm01_00075590 predicted 1582
9 SASI_Mm01_00075591 predicted 1099
10 SASI_Mm01_00075592 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114064 predicted 615
2 SASI_Mm01_00114065 predicted 988
3 SASI_Mm01_00114066 predicted 1429
4 SASI_Mm01_00114067 predicted 913
5 SASI_Mm01_00114068 predicted 1293
6 SASI_Mm01_00114069 predicted 1097
7 SASI_Mm01_00114070 predicted 1427
8 SASI_Mm01_00114071 predicted 1093
9 SASI_Mm01_00114072 predicted 1438
10 SASI_Mm01_00114073 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199647 predicted 622
2 SASI_Mm01_00199648 predicted 980
3 SASI_Mm01_00199649 predicted 1425
4 SASI_Mm01_00199650 predicted 910
5 SASI_Mm01_00199651 predicted 1291
6 SASI_Mm01_00199652 predicted 1094
7 SASI_Mm01_00199653 predicted 1433
8 SASI_Mm01_00199654 predicted 1093
9 SASI_Mm01_00199655 predicted 1446
10 SASI_Mm01_00199656 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299092 predicted 716
2 SASI_Mm02_00299093 predicted 1088
3 SASI_Mm02_00299094 predicted 1012
4 SASI_Mm02_00299095 predicted 261
5 SASI_Mm02_00299096 predicted 1388
6 SASI_Mm02_00299097 predicted 1195
7 SASI_Mm02_00299098 predicted 1192
8 SASI_Mm02_00299099 predicted 1373
9 SASI_Mm02_00299100 predicted 311
10 SASI_Mm02_00299101 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032114 predicted 711
2 SASI_Mm01_00032115 predicted 1089
3 SASI_Mm01_00032117 predicted 1013
4 SASI_Mm02_00313944 predicted 257
5 SASI_Mm01_00032118 predicted 1386
6 SASI_Mm01_00032119 predicted 1199
7 SASI_Mm01_00032121 predicted 1200
8 SASI_Mm01_00032123 predicted 1372
9 SASI_Mm02_00313945 predicted 310
10 SASI_Mm02_00313946 predicted 256
11 SASI_Mm01_00032116 predicted 1429
12 SASI_Mm01_00032120 predicted 1432
13 SASI_Mm01_00032122 predicted 1448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005552
VALIDATED
KLC1 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1289s1c1
Sequence:CCGGGCAGTTAAATAACTTGGCCTTCTCGAGAAGGCCAAGTTATTTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-711s1c1
Sequence:CCGGCTGGAGTTTATGAATCAGCTACTCGAGTAGCTGATTCATAAACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1431s1c1
Sequence:CCGGGCATCCTGCTATTTGAAACAACTCGAGTTGTTTCAAATAGCAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2174s1c1
Sequence:CCGGGCCAGATATGTACTTAGTAATCTCGAGATTACTAAGTACATATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1633s1c1
Sequence:CCGGCCTGCAAAGTTGATAGTCCAACTCGAGTTGGACTATCAACTTTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2431s1c1
Sequence:CCGGCCCAGTAGCATTTGCTGTGTACTCGAGTACACAGCAAATGCTACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1651s21c1
Sequence:CCGGAGTATGGCGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCGCCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-359s21c1
Sequence:CCGGGAAGCTTACACAGGATGAAATCTCGAGATTTCATCCTGTGTAAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1367s21c1
Sequence:CCGGCAAGTATGAAGAAGTAGAATACTCGAGTATTCTACTTCTTCATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-2361s21c1
Sequence:CCGGTGACCTGTTGACGTAACTAAGCTCGAGCTTAGTTACGTCAACAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-752s21c1
Sequence:CCGGGGAGTTTATGAATCAGCTAAACTCGAGTTTAGCTGATTCATAAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1317s21c1
Sequence:CCGGGATGTTGCCAAGCAGTTAAATCTCGAGATTTAACTGCTTGGCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005552.4-2261s21c1
Sequence:CCGGCTGTGTAATACACGAGTTTAACTCGAGTTAAACTCGTGTATTACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1774s21c1
Sequence:CCGGCTGCTATGAGGTCTCGTAAACCTCGAGGTTTACGAGACCTCATAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005552
VALIDATED
KLC1 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1289s1c1
Sequence:CCGGGCAGTTAAATAACTTGGCCTTCTCGAGAAGGCCAAGTTATTTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-711s1c1
Sequence:CCGGCTGGAGTTTATGAATCAGCTACTCGAGTAGCTGATTCATAAACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1431s1c1
Sequence:CCGGGCATCCTGCTATTTGAAACAACTCGAGTTGTTTCAAATAGCAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2174s1c1
Sequence:CCGGGCCAGATATGTACTTAGTAATCTCGAGATTACTAAGTACATATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1633s1c1
Sequence:CCGGCCTGCAAAGTTGATAGTCCAACTCGAGTTGGACTATCAACTTTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2431s1c1
Sequence:CCGGCCCAGTAGCATTTGCTGTGTACTCGAGTACACAGCAAATGCTACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1651s21c1
Sequence:CCGGAGTATGGCGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCGCCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-359s21c1
Sequence:CCGGGAAGCTTACACAGGATGAAATCTCGAGATTTCATCCTGTGTAAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1367s21c1
Sequence:CCGGCAAGTATGAAGAAGTAGAATACTCGAGTATTCTACTTCTTCATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-2361s21c1
Sequence:CCGGTGACCTGTTGACGTAACTAAGCTCGAGCTTAGTTACGTCAACAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-752s21c1
Sequence:CCGGGGAGTTTATGAATCAGCTAAACTCGAGTTTAGCTGATTCATAAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1317s21c1
Sequence:CCGGGATGTTGCCAAGCAGTTAAATCTCGAGATTTAACTGCTTGGCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005552.4-2261s21c1
Sequence:CCGGCTGTGTAATACACGAGTTTAACTCGAGTTAAACTCGTGTATTACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1774s21c1
Sequence:CCGGCTGCTATGAGGTCTCGTAAACCTCGAGGTTTACGAGACCTCATAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005552
VALIDATED
KLC1 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1289s1c1
Sequence:CCGGGCAGTTAAATAACTTGGCCTTCTCGAGAAGGCCAAGTTATTTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-711s1c1
Sequence:CCGGCTGGAGTTTATGAATCAGCTACTCGAGTAGCTGATTCATAAACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1431s1c1
Sequence:CCGGGCATCCTGCTATTTGAAACAACTCGAGTTGTTTCAAATAGCAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2174s1c1
Sequence:CCGGGCCAGATATGTACTTAGTAATCTCGAGATTACTAAGTACATATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005552.3-1633s1c1
Sequence:CCGGCCTGCAAAGTTGATAGTCCAACTCGAGTTGGACTATCAACTTTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005552.3-2431s1c1
Sequence:CCGGCCCAGTAGCATTTGCTGTGTACTCGAGTACACAGCAAATGCTACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1651s21c1
Sequence:CCGGAGTATGGCGGCTGGTACAAAGCTCGAGCTTTGTACCAGCCGCCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-359s21c1
Sequence:CCGGGAAGCTTACACAGGATGAAATCTCGAGATTTCATCCTGTGTAAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1367s21c1
Sequence:CCGGCAAGTATGAAGAAGTAGAATACTCGAGTATTCTACTTCTTCATACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-2361s21c1
Sequence:CCGGTGACCTGTTGACGTAACTAAGCTCGAGCTTAGTTACGTCAACAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-752s21c1
Sequence:CCGGGGAGTTTATGAATCAGCTAAACTCGAGTTTAGCTGATTCATAAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1317s21c1
Sequence:CCGGGATGTTGCCAAGCAGTTAAATCTCGAGATTTAACTGCTTGGCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005552.4-2261s21c1
Sequence:CCGGCTGTGTAATACACGAGTTTAACTCGAGTTAAACTCGTGTATTACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005552.4-1774s21c1
Sequence:CCGGCTGCTATGAGGTCTCGTAAACCTCGAGGTTTACGAGACCTCATAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025358
VALIDATED
KLC1 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025358.1-617s1c1
Sequence:CCGGCGTTGGATGATCTCTTCCCAACTCGAGTTGGGAAGAGATCATCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-246s1c1
Sequence:CCGGGACGCTGAAGTGCTTGAAGAACTCGAGTTCTTCAAGCACTTCAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1440s1c1
Sequence:CCGGCGGCTGGTATAAAGCCTGCAACTCGAGTTGCAGGCTTTATACCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1093s1c1
Sequence:CCGGCCTGATGTTGCCAAACAGTTACTCGAGTAACTGTTTGGCAACATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-364s1c1
Sequence:CCGGGCGCTGTCCAATCACCTGAATCTCGAGATTCAGGTGATTGGACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025358
VALIDATED
KLC1 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025358.1-617s1c1
Sequence:CCGGCGTTGGATGATCTCTTCCCAACTCGAGTTGGGAAGAGATCATCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-246s1c1
Sequence:CCGGGACGCTGAAGTGCTTGAAGAACTCGAGTTCTTCAAGCACTTCAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1440s1c1
Sequence:CCGGCGGCTGGTATAAAGCCTGCAACTCGAGTTGCAGGCTTTATACCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1093s1c1
Sequence:CCGGCCTGATGTTGCCAAACAGTTACTCGAGTAACTGTTTGGCAACATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-364s1c1
Sequence:CCGGGCGCTGTCCAATCACCTGAATCTCGAGATTCAGGTGATTGGACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025358
VALIDATED
KLC1 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025358.1-617s1c1
Sequence:CCGGCGTTGGATGATCTCTTCCCAACTCGAGTTGGGAAGAGATCATCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-246s1c1
Sequence:CCGGGACGCTGAAGTGCTTGAAGAACTCGAGTTCTTCAAGCACTTCAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1440s1c1
Sequence:CCGGCGGCTGGTATAAAGCCTGCAACTCGAGTTGCAGGCTTTATACCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-1093s1c1
Sequence:CCGGCCTGATGTTGCCAAACAGTTACTCGAGTAACTGTTTGGCAACATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_001025358.1-364s1c1
Sequence:CCGGGCGCTGTCCAATCACCTGAATCTCGAGATTCAGGTGATTGGACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)