EMAIL THIS PAGE TO A FRIEND

KLC3

kinesin light chain 3

128 Gene Product Result for
Synonyms: KLC2 KLC2L KLCt KNS2B
UniProtKB ID: Q6P597, A0AVM3, A2RUT6, Q6GMU2, Q8NAL1, Q8WWJ9
Gene ID:
Human(147700) Summary: This gene encodes a member of the kinesin light chain gene family. Kinesins are molecular motors involved in the transport of cargo along microtubules, and are composed of two kinesin heavy chain (KHC) and two kinesin light chain (KLC) molecules. KLCs are thought to typically be involved in binding cargo and regulating kinesin activity. In the rat, a protein similar to this gene product is expressed in post-meiotic spermatids, where it associates with structural components of sperm tails and mitochondria. [provided by RefSeq, Jul 2008]
Mouse(232943) kinesin light chain 3
Rat(171549) kinesin light chain 3
sheep(101116082) kinesin light chain 3
domestic guinea pig(100721039) kinesin light chain 3
naked mole-rat(101698001) kinesin light chain 3
Zebrafish(569394) kinesin light chain 3
cow(517633) kinesin light chain 3
domestic cat(101084245) kinesin light chain 3
dog(484448) kinesin light chain 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073511 MISSION® esiRNA esiRNA human KLC3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177417 Rosetta Predictions human pricing
NM_138520 Rosetta Predictions rat pricing
NM_146182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151679 predicted 1059
2 SASI_Hs01_00151681 predicted 1505
3 SASI_Hs02_00369315 predicted 290
4 SASI_Hs02_00369316 predicted 1060
5 SASI_Hs01_00151684 predicted 1523
6 SASI_Hs01_00151686 predicted 984
7 SASI_Hs02_00369317 predicted 1170
8 SASI_Hs02_00369318 predicted 1028
9 SASI_Hs02_00369319 predicted 1059
10 SASI_Hs02_00369320 predicted 1491
11 SASI_Hs01_00151680 predicted 1370
12 SASI_Hs01_00151682 predicted 1267
13 SASI_Hs01_00151683 predicted 1423
14 SASI_Hs01_00151685 predicted 1403
15 SASI_Hs01_00151687 predicted 1414
16 SASI_Hs01_00151688 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067350 predicted 1129
2 SASI_Rn01_00067351 predicted 1136
3 SASI_Rn02_00268136 predicted 194
4 SASI_Rn01_00067352 predicted 970
5 SASI_Rn01_00067353 predicted 1064
6 SASI_Rn02_00268137 predicted 846
7 SASI_Rn01_00067354 predicted 1307
8 SASI_Rn01_00067355 predicted 1327
9 SASI_Rn01_00067356 predicted 354
10 SASI_Rn01_00067357 predicted 810
11 SASI_Rn01_00067358 predicted 865
12 SASI_Rn01_00067359 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054596 predicted 566
2 SASI_Mm01_00054597 predicted 1001
3 SASI_Mm01_00054598 predicted 1169
4 SASI_Mm01_00054599 predicted 996
5 SASI_Mm01_00054601 predicted 936
6 SASI_Mm01_00054602 predicted 846
7 SASI_Mm01_00054603 predicted 847
8 SASI_Mm02_00341881 predicted 875
9 SASI_Mm01_00054604 predicted 394
10 SASI_Mm01_00054605 predicted 1115
11 SASI_Mm01_00054600 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146182
VALIDATED
KLC3 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-1607s1c1
Sequence:CCGGCAGCTTCTCAAGGATCAGGAACTCGAGTTCCTGATCCTTGAGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-946s1c1
Sequence:CCGGCCTGGCTGTCCTCTATGGAAACTCGAGTTTCCATAGAGGACAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-131s1c1
Sequence:CCGGCGGCAGACACGACAGGTTGTACTCGAGTACAACCTGTCGTGTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-826s1c1
Sequence:CCGGACTCGTGTACAGGGACCAGAACTCGAGTTCTGGTCCCTGTACACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-395s1c1
Sequence:CCGGGCCCAAGAGAACACATGGCTTCTCGAGAAGCCATGTGTTCTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146182
VALIDATED
KLC3 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-1607s1c1
Sequence:CCGGCAGCTTCTCAAGGATCAGGAACTCGAGTTCCTGATCCTTGAGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-946s1c1
Sequence:CCGGCCTGGCTGTCCTCTATGGAAACTCGAGTTTCCATAGAGGACAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-131s1c1
Sequence:CCGGCGGCAGACACGACAGGTTGTACTCGAGTACAACCTGTCGTGTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-826s1c1
Sequence:CCGGACTCGTGTACAGGGACCAGAACTCGAGTTCTGGTCCCTGTACACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-395s1c1
Sequence:CCGGGCCCAAGAGAACACATGGCTTCTCGAGAAGCCATGTGTTCTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146182
VALIDATED
KLC3 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-1607s1c1
Sequence:CCGGCAGCTTCTCAAGGATCAGGAACTCGAGTTCCTGATCCTTGAGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-946s1c1
Sequence:CCGGCCTGGCTGTCCTCTATGGAAACTCGAGTTTCCATAGAGGACAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-131s1c1
Sequence:CCGGCGGCAGACACGACAGGTTGTACTCGAGTACAACCTGTCGTGTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-826s1c1
Sequence:CCGGACTCGTGTACAGGGACCAGAACTCGAGTTCTGGTCCCTGTACACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146182.1-395s1c1
Sequence:CCGGGCCCAAGAGAACACATGGCTTCTCGAGAAGCCATGTGTTCTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177417
KLC3 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1300s1c1
Sequence:CCGGGAAACAGAACAAGTATCAACACTCGAGTGTTGATACTTGTTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1438s1c1
Sequence:CCGGCTCCAAGATCCGTGAGTCTATCTCGAGATAGACTCACGGATCTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1024s1c1
Sequence:CCGGCAACAACTTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAAGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-931s1c1
Sequence:CCGGCAAGTACAAAGAAGCCACAGACTCGAGTCTGTGGCTTCTTTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1533s1c1
Sequence:CCGGCCATGTCACTCAACACACTGACTCGAGTCAGTGTGTTGAGTGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1306s1c1
Sequence:CCGGGAACAAGTATCAACAAGCGGACTCGAGTCCGCTTGTTGATACTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1063s21c1
Sequence:CCGGCGCTTTGGAGATCCGAGAGAACTCGAGTTCTCTCGGATCTCCAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1231s21c1
Sequence:CCGGCAACGTGGCCAAGACCAAGAACTCGAGTTCTTGGTCTTGGCCACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-745s21c1
Sequence:CCGGGCATAACCTCGTGATCCAGTACTCGAGTACTGGATCACGAGGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177417
KLC3 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1300s1c1
Sequence:CCGGGAAACAGAACAAGTATCAACACTCGAGTGTTGATACTTGTTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1438s1c1
Sequence:CCGGCTCCAAGATCCGTGAGTCTATCTCGAGATAGACTCACGGATCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1024s1c1
Sequence:CCGGCAACAACTTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAAGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-931s1c1
Sequence:CCGGCAAGTACAAAGAAGCCACAGACTCGAGTCTGTGGCTTCTTTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1533s1c1
Sequence:CCGGCCATGTCACTCAACACACTGACTCGAGTCAGTGTGTTGAGTGACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1306s1c1
Sequence:CCGGGAACAAGTATCAACAAGCGGACTCGAGTCCGCTTGTTGATACTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1063s21c1
Sequence:CCGGCGCTTTGGAGATCCGAGAGAACTCGAGTTCTCTCGGATCTCCAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1231s21c1
Sequence:CCGGCAACGTGGCCAAGACCAAGAACTCGAGTTCTTGGTCTTGGCCACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-745s21c1
Sequence:CCGGGCATAACCTCGTGATCCAGTACTCGAGTACTGGATCACGAGGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177417
KLC3 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1300s1c1
Sequence:CCGGGAAACAGAACAAGTATCAACACTCGAGTGTTGATACTTGTTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1438s1c1
Sequence:CCGGCTCCAAGATCCGTGAGTCTATCTCGAGATAGACTCACGGATCTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1024s1c1
Sequence:CCGGCAACAACTTGGCTGTCCTCTACTCGAGTAGAGGACAGCCAAGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-931s1c1
Sequence:CCGGCAAGTACAAAGAAGCCACAGACTCGAGTCTGTGGCTTCTTTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1533s1c1
Sequence:CCGGCCATGTCACTCAACACACTGACTCGAGTCAGTGTGTTGAGTGACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177417.1-1306s1c1
Sequence:CCGGGAACAAGTATCAACAAGCGGACTCGAGTCCGCTTGTTGATACTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1063s21c1
Sequence:CCGGCGCTTTGGAGATCCGAGAGAACTCGAGTTCTCTCGGATCTCCAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-1231s21c1
Sequence:CCGGCAACGTGGCCAAGACCAAGAACTCGAGTTCTTGGTCTTGGCCACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177417.2-745s21c1
Sequence:CCGGGCATAACCTCGTGATCCAGTACTCGAGTACTGGATCACGAGGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)