EMAIL THIS PAGE TO A FRIEND

KLF10

Kruppel-like factor 10

147 Gene Product Result for
Synonyms: EGR-alpha EGRA TIEG TIEG1
Gene ID:
Human(7071) Summary: This gene encodes a member of a family of proteins that feature C2H2-type zinc finger domains. The encoded protein is a transcriptional repressor that acts as an effector of transforming growth factor beta signaling. Activity of this protein may inhibit the growth of cancers, particularly pancreatic cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(21847) Kruppel-like factor 10
Rat(81813) Kruppel-like factor 10
domestic guinea pig(100720582) Kruppel-like factor 10
naked mole-rat(101721004) Kruppel-like factor 10
sheep(101104073) Kruppel-like factor 10
Domestic Rabbit(100338474) Kruppel-like factor 10
Zebrafish(324271) Kruppel-like factor 10
domestic cat(101100280) Kruppel-like factor 10
Horse(100062273) Kruppel-like factor 10
cow(522795) Kruppel-like factor 10
dog(481992) Kruppel-like factor 10
chicken(420255) Kruppel-like factor 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38662 Anti-KLF10 (AB1) antibody produced in rabbit IgG fraction of antiserum human, rabbit, horse
western blot pricing
SAB1412504 ANTI-KLF10 antibody produced in mouse clone 2H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412643 ANTI-KLF10 antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2101271 Anti-KLF10 antibody produced in rabbit affinity isolated antibody canine, bovine, human, rat, horse, pig, mouse, rabbit, guinea pig
western blot pricing
SAB2104074 Anti-KLF10 antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, rabbit, horse, mouse, pig, canine, bovine
western blot pricing
SAB2106445 Anti-KLF10 antibody produced in rabbit affinity isolated antibody canine, rabbit, zebrafish, rat, human, mouse, horse, guinea pig
immunohistochemistry, western blot pricing
SAB4502970 Anti-KLF10, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB1306109 ANTI-TIEG (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
SAB1306385 ANTI-TIEG(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0007071M2 Monoclonal Anti-KLF10 antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
SAB1404468 Monoclonal Anti-KLF10 antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005655 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032282 Rosetta Predictions human pricing
NM_005655 Rosetta Predictions human pricing
NM_031135 Rosetta Predictions rat pricing
NM_013692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063443 predicted 1361
2 SASI_Hs01_00063444 predicted 646
3 SASI_Hs02_00307862 predicted 1475
4 SASI_Hs01_00063445 predicted 1499
5 SASI_Hs01_00063447 predicted 665
6 SASI_Hs01_00063448 predicted 1509
7 SASI_Hs01_00063449 predicted 1359
8 SASI_Hs01_00063450 predicted 1514
9 SASI_Hs02_00307863 predicted 904
10 SASI_Hs01_00063451 predicted 660
11 SASI_Hs01_00063446 predicted 656
12 SASI_Hs01_00063452 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231862 predicted 1196
2 SASI_Hs01_00231863 predicted 485
3 SASI_Hs02_00340023 predicted 1307
4 SASI_Hs01_00231864 predicted 1338
5 SASI_Hs01_00231866 predicted 506
6 SASI_Hs01_00231867 predicted 1341
7 SASI_Hs01_00231868 predicted 1198
8 SASI_Hs01_00231869 predicted 1359
9 SASI_Hs02_00340024 predicted 741
10 SASI_Hs01_00231870 predicted 501
11 SASI_Hs01_00231865 predicted 491
12 SASI_Hs01_00231871 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055560 predicted 881
2 SASI_Rn02_00264461 predicted 1119
3 SASI_Rn01_00055561 predicted 1265
4 SASI_Rn01_00055562 predicted 604
5 SASI_Rn01_00055563 predicted 1435
6 SASI_Rn02_00264462 predicted 1491
7 SASI_Rn01_00055564 predicted 571
8 SASI_Rn01_00055565 predicted 564
9 SASI_Rn01_00055566 predicted 882
10 SASI_Rn01_00055567 predicted 606
11 SASI_Rn01_00055568 predicted 1818
12 SASI_Rn01_00055569 predicted 1632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094222 predicted 1403
2 SASI_Mm01_00094223 predicted 307
3 SASI_Mm01_00094224 predicted 628
4 SASI_Mm01_00094225 predicted 819
5 SASI_Mm01_00094226 predicted 1184
6 SASI_Mm01_00094227 predicted 950
7 SASI_Mm02_00322581 predicted 460
8 SASI_Mm01_00094228 predicted 1324
9 SASI_Mm01_00094229 predicted 1254
10 SASI_Mm01_00094230 predicted 1600
11 SASI_Mm01_00094231 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013692
VALIDATED
KLF10 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 10
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-691s21c1
Sequence:CCGGAGGCTACTCGAAAGAACATACCTCGAGGTATGTTCTTTCGAGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1335s21c1
Sequence:CCGGAGGTTTGCTCGCTCCGATGAACTCGAGTTCATCGGAGCGAGCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-1559s21c1
Sequence:CCGGAGAAGATGGAGACGCAGAATACTCGAGTATTCTGCGTCTCCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2044s21c1
Sequence:CCGGCCGTGGATGTAGCTAAGTATACTCGAGTATACTTAGCTACATCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-631s21c1
Sequence:CCGGCAGCTAGCATCCTCAACTATCCTCGAGGATAGTTGAGGATGCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2136s21c1
Sequence:CCGGAGGATTGGAACCCTCATTAATCTCGAGATTAATGAGGGTTCCAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013692.2-451s21c1
Sequence:CCGGCATCTACTGGCCACTTCAAATCTCGAGATTTGAAGTGGCCAGTAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1422s21c1
Sequence:CCGGTTTATGAGGAGCGACCATTTACTCGAGTAAATGGTCGCTCCTCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1234s21c1
Sequence:CCGGGGTGTGGCAAGACTTACTTTACTCGAGTAAAGTAAGTCTTGCCACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-666s21c1
Sequence:CCGGCGGAGAAGAACCCACGGAAATCTCGAGATTTCCGTGGGTTCTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-784s21c1
Sequence:CCGGGCGCTGCACTATATGACTTTGCTCGAGCAAAGTCATATAGTGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-258s21c1
Sequence:CCGGTGCGACTGGAAGTCTCATTTCCTCGAGGAAATGAGACTTCCAGTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1494s21c1
Sequence:CCGGATGGAAGTTAGCAAGTTAAATCTCGAGATTTAACTTGCTAACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1404s1c1
Sequence:CCGGCCCATGTGTGACCGTCGGTTTCTCGAGAAACCGACGGTCACACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1235s1c1
Sequence:CCGGGTGTGGCAAGACTTACTTTAACTCGAGTTAAAGTAAGTCTTGCCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-260s1c1
Sequence:CCGGCGACTGGAAGTCTCATTTCAACTCGAGTTGAAATGAGACTTCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013692.1-1933s1c1
Sequence:CCGGGCTGGAAATTACGGTACAGAACTCGAGTTCTGTACCGTAATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-665s1c1
Sequence:CCGGCCGGAGAAGAACCCACGGAAACTCGAGTTTCCGTGGGTTCTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013692
VALIDATED
KLF10 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 10
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-691s21c1
Sequence:CCGGAGGCTACTCGAAAGAACATACCTCGAGGTATGTTCTTTCGAGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1335s21c1
Sequence:CCGGAGGTTTGCTCGCTCCGATGAACTCGAGTTCATCGGAGCGAGCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-1559s21c1
Sequence:CCGGAGAAGATGGAGACGCAGAATACTCGAGTATTCTGCGTCTCCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2044s21c1
Sequence:CCGGCCGTGGATGTAGCTAAGTATACTCGAGTATACTTAGCTACATCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-631s21c1
Sequence:CCGGCAGCTAGCATCCTCAACTATCCTCGAGGATAGTTGAGGATGCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2136s21c1
Sequence:CCGGAGGATTGGAACCCTCATTAATCTCGAGATTAATGAGGGTTCCAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013692.2-451s21c1
Sequence:CCGGCATCTACTGGCCACTTCAAATCTCGAGATTTGAAGTGGCCAGTAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1422s21c1
Sequence:CCGGTTTATGAGGAGCGACCATTTACTCGAGTAAATGGTCGCTCCTCATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1234s21c1
Sequence:CCGGGGTGTGGCAAGACTTACTTTACTCGAGTAAAGTAAGTCTTGCCACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-666s21c1
Sequence:CCGGCGGAGAAGAACCCACGGAAATCTCGAGATTTCCGTGGGTTCTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-784s21c1
Sequence:CCGGGCGCTGCACTATATGACTTTGCTCGAGCAAAGTCATATAGTGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-258s21c1
Sequence:CCGGTGCGACTGGAAGTCTCATTTCCTCGAGGAAATGAGACTTCCAGTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1494s21c1
Sequence:CCGGATGGAAGTTAGCAAGTTAAATCTCGAGATTTAACTTGCTAACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1404s1c1
Sequence:CCGGCCCATGTGTGACCGTCGGTTTCTCGAGAAACCGACGGTCACACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1235s1c1
Sequence:CCGGGTGTGGCAAGACTTACTTTAACTCGAGTTAAAGTAAGTCTTGCCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-260s1c1
Sequence:CCGGCGACTGGAAGTCTCATTTCAACTCGAGTTGAAATGAGACTTCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013692.1-1933s1c1
Sequence:CCGGGCTGGAAATTACGGTACAGAACTCGAGTTCTGTACCGTAATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-665s1c1
Sequence:CCGGCCGGAGAAGAACCCACGGAAACTCGAGTTTCCGTGGGTTCTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013692
VALIDATED
KLF10 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 10
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-691s21c1
Sequence:CCGGAGGCTACTCGAAAGAACATACCTCGAGGTATGTTCTTTCGAGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1335s21c1
Sequence:CCGGAGGTTTGCTCGCTCCGATGAACTCGAGTTCATCGGAGCGAGCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-1559s21c1
Sequence:CCGGAGAAGATGGAGACGCAGAATACTCGAGTATTCTGCGTCTCCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2044s21c1
Sequence:CCGGCCGTGGATGTAGCTAAGTATACTCGAGTATACTTAGCTACATCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-631s21c1
Sequence:CCGGCAGCTAGCATCCTCAACTATCCTCGAGGATAGTTGAGGATGCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013692.2-2136s21c1
Sequence:CCGGAGGATTGGAACCCTCATTAATCTCGAGATTAATGAGGGTTCCAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013692.2-451s21c1
Sequence:CCGGCATCTACTGGCCACTTCAAATCTCGAGATTTGAAGTGGCCAGTAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1422s21c1
Sequence:CCGGTTTATGAGGAGCGACCATTTACTCGAGTAAATGGTCGCTCCTCATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1234s21c1
Sequence:CCGGGGTGTGGCAAGACTTACTTTACTCGAGTAAAGTAAGTCTTGCCACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-666s21c1
Sequence:CCGGCGGAGAAGAACCCACGGAAATCTCGAGATTTCCGTGGGTTCTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-784s21c1
Sequence:CCGGGCGCTGCACTATATGACTTTGCTCGAGCAAAGTCATATAGTGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-258s21c1
Sequence:CCGGTGCGACTGGAAGTCTCATTTCCTCGAGGAAATGAGACTTCCAGTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013692.2-1494s21c1
Sequence:CCGGATGGAAGTTAGCAAGTTAAATCTCGAGATTTAACTTGCTAACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1404s1c1
Sequence:CCGGCCCATGTGTGACCGTCGGTTTCTCGAGAAACCGACGGTCACACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-1235s1c1
Sequence:CCGGGTGTGGCAAGACTTACTTTAACTCGAGTTAAAGTAAGTCTTGCCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-260s1c1
Sequence:CCGGCGACTGGAAGTCTCATTTCAACTCGAGTTGAAATGAGACTTCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013692.1-1933s1c1
Sequence:CCGGGCTGGAAATTACGGTACAGAACTCGAGTTCTGTACCGTAATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013692.1-665s1c1
Sequence:CCGGCCGGAGAAGAACCCACGGAAACTCGAGTTTCCGTGGGTTCTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005655
VALIDATED
KLF10 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-458s21c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005655.2-346s21c1
Sequence:CCGGTGTTACACCAGTATCTGATTTCTCGAGAAATCAGATACTGGTGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1278s21c1
Sequence:CCGGGATGTGGCAAGACATACTTTACTCGAGTAAAGTATGTCTTGCCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1538s21c1
Sequence:CCGGATGGAAGTGAGCAAGCTAAATCTCGAGATTTAGCTTGCTCACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1889s21c1
Sequence:CCGGTTGAATCTGTGTGCATATTTGCTCGAGCAAATATGCACACAGATTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-747s1c1
Sequence:CCGGCAGATCCAAATGTGAGAGAAACTCGAGTTTCTCTCACATTTGGATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-1196s1c1
Sequence:CCGGCTCCTCAGATTGATTCATCAACTCGAGTTGATGAATCAATCTGAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-198s1c1
Sequence:CCGGGAGTATGTATTCCTGGAACAACTCGAGTTGTTCCAGGAATACATACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-427s1c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-1325s1c1
Sequence:CCGGGTAGCTGGAAAGGTTGTGAAACTCGAGTTTCACAACCTTTCCAGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005655
VALIDATED
KLF10 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-458s21c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005655.2-346s21c1
Sequence:CCGGTGTTACACCAGTATCTGATTTCTCGAGAAATCAGATACTGGTGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1278s21c1
Sequence:CCGGGATGTGGCAAGACATACTTTACTCGAGTAAAGTATGTCTTGCCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1538s21c1
Sequence:CCGGATGGAAGTGAGCAAGCTAAATCTCGAGATTTAGCTTGCTCACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1889s21c1
Sequence:CCGGTTGAATCTGTGTGCATATTTGCTCGAGCAAATATGCACACAGATTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-747s1c1
Sequence:CCGGCAGATCCAAATGTGAGAGAAACTCGAGTTTCTCTCACATTTGGATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-1196s1c1
Sequence:CCGGCTCCTCAGATTGATTCATCAACTCGAGTTGATGAATCAATCTGAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-198s1c1
Sequence:CCGGGAGTATGTATTCCTGGAACAACTCGAGTTGTTCCAGGAATACATACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-427s1c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-1325s1c1
Sequence:CCGGGTAGCTGGAAAGGTTGTGAAACTCGAGTTTCACAACCTTTCCAGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005655
VALIDATED
KLF10 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-458s21c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005655.2-346s21c1
Sequence:CCGGTGTTACACCAGTATCTGATTTCTCGAGAAATCAGATACTGGTGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1278s21c1
Sequence:CCGGGATGTGGCAAGACATACTTTACTCGAGTAAAGTATGTCTTGCCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1538s21c1
Sequence:CCGGATGGAAGTGAGCAAGCTAAATCTCGAGATTTAGCTTGCTCACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005655.2-1889s21c1
Sequence:CCGGTTGAATCTGTGTGCATATTTGCTCGAGCAAATATGCACACAGATTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-747s1c1
Sequence:CCGGCAGATCCAAATGTGAGAGAAACTCGAGTTTCTCTCACATTTGGATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-1196s1c1
Sequence:CCGGCTCCTCAGATTGATTCATCAACTCGAGTTGATGAATCAATCTGAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005655.1-198s1c1
Sequence:CCGGGAGTATGTATTCCTGGAACAACTCGAGTTGTTCCAGGAATACATACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-427s1c1
Sequence:CCGGGAACCCTCTCAAGTGTCAAATCTCGAGATTTGACACTTGAGAGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005655.1-1325s1c1
Sequence:CCGGGTAGCTGGAAAGGTTGTGAAACTCGAGTTTCACAACCTTTCCAGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)