EMAIL THIS PAGE TO A FRIEND

KLF11

Kruppel-like factor 11

74 Gene Product Result for
Synonyms: FKLF FKLF1 MODY7 TIEG2 Tieg3
UniProtKB ID: O14901, B4DZE7, Q9EPF4
Gene ID:
Human(8462) Summary: The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(194655) Kruppel-like factor 11
Rat(313994) Kruppel-like factor 11
chicken(421934) Kruppel-like factor 11
dog(475665) Kruppel-like factor 11
cow(616730) Kruppel-like factor 11
Horse(100072433) Kruppel-like factor 11
domestic cat(101095490) Kruppel-like factor 11
sheep(101117833) Kruppel-like factor 11
domestic guinea pig(100715755) Kruppel-like factor 11
naked mole-rat(101701008) Kruppel-like factor 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38365 Anti-KLF11 antibody produced in rabbit affinity isolated antibody canine, pig, horse, rat, bovine, mouse, human, guinea pig, rabbit, zebrafish,
western blot pricing
AV30042 Anti-KLF11 antibody produced in rabbit IgG fraction of antiserum guinea pig, human, rabbit, horse, rat, bovine, canine, pig
western blot pricing
SAB2105386 Anti-KLF11 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB4503372 Anti-KLF11 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
HPA058276 Anti-KLF11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB1306568 ANTI-TIEG2(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
WH0008462M1 Monoclonal Anti-KLF11 antibody produced in mouse clone 8F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409899 Monoclonal Anti-KLF11 antibody produced in mouse clone 10C5, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1404583 Monoclonal Anti-KLF11, (C-terminal) antibody produced in mouse clone 10D8, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003597 Rosetta Predictions human pricing
NM_001037354 Rosetta Predictions rat pricing
NM_178357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098506 predicted 929
2 SASI_Hs01_00098507 predicted 448
3 SASI_Hs01_00098508 predicted 803
4 SASI_Hs01_00098509 predicted 2191
5 SASI_Hs01_00098510 predicted 2187
6 SASI_Hs01_00098511 predicted 741
7 SASI_Hs01_00098512 predicted 1326
8 SASI_Hs01_00098513 predicted 725
9 SASI_Hs01_00098514 predicted 1542
10 SASI_Hs01_00098515 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097541 predicted 315
2 SASI_Rn01_00097542 predicted 1195
3 SASI_Rn01_00097545 predicted 785
4 SASI_Rn01_00097546 predicted 677
5 SASI_Rn01_00097547 predicted 664
6 SASI_Rn02_00204400 predicted 314
7 SASI_Rn01_00097548 predicted 814
8 SASI_Rn02_00204401 predicted 1161
9 SASI_Rn01_00097549 predicted 1329
10 SASI_Rn01_00097550 predicted 688
11 SASI_Rn01_00097543 predicted 1321
12 SASI_Rn01_00097544 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348740 predicted 995
2 SASI_Mm01_00174528 predicted 605
3 SASI_Mm01_00174529 predicted 878
4 SASI_Mm01_00174530 predicted 505
5 SASI_Mm01_00174531 predicted 1011
6 SASI_Mm01_00174532 predicted 888
7 SASI_Mm01_00174533 predicted 985
8 SASI_Mm01_00174535 predicted 1511
9 SASI_Mm02_00348741 predicted 376
10 SASI_Mm01_00174536 predicted 884
11 SASI_Mm01_00174534 predicted 1540
12 SASI_Mm01_00174537 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003597
VALIDATED
KLF11 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 11
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003597.4-2755s1c1
Sequence:CCGGCCGCTTCCTTTGTTTGCCAAACTCGAGTTTGGCAAACAAAGGAAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-258s1c1
Sequence:CCGGCGAAAGGTCTACTTGCAGCATCTCGAGATGCTGCAAGTAGACCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-938s1c1
Sequence:CCGGGCTCACCAAAGAATTATGAAACTCGAGTTTCATAATTCTTTGGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-1584s1c1
Sequence:CCGGGCGCCACATGACGACCAAGAACTCGAGTTCTTGGTCGTCATGTGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-201s1c1
Sequence:CCGGCGCAGTTGACATCATGGACATCTCGAGATGTCCATGATGTCAACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-811s21c1
Sequence:CCGGACACACCTCACGGACAGTTTACTCGAGTAAACTGTCCGTGAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1692s21c1
Sequence:CCGGCTCTGCCTGAAAGGTCCATTACTCGAGTAATGGACCTTTCAGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1232s21c1
Sequence:CCGGATGTCATGGCTGCCGGGAATACTCGAGTATTCCCGGCAGCCATGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1029s21c1
Sequence:CCGGGATCCCTGTGACTGGACAAAGCTCGAGCTTTGTCCAGTCACAGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-402s21c1
Sequence:CCGGTGTCACCACCACTGTGCATATCTCGAGATATGCACAGTGGTGGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2940s21c1
Sequence:CCGGACTGTATGAGCACGTAGATAACTCGAGTTATCTACGTGCTCATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1329s21c1
Sequence:CCGGCCGAAGGAGGAACTATGTTTGCTCGAGCAAACATAGTTCCTCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-462s21c1
Sequence:CCGGTTTATCGACTCTGTGCATAACCTCGAGGTTATGCACAGAGTCGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2618s21c1
Sequence:CCGGTGGCCTTATCCGTACTATATTCTCGAGAATATAGTACGGATAAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-351s21c1
Sequence:CCGGAGGTGACCTGTTGCGGATAAGCTCGAGCTTATCCGCAACAGGTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003597
VALIDATED
KLF11 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 11
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003597.4-2755s1c1
Sequence:CCGGCCGCTTCCTTTGTTTGCCAAACTCGAGTTTGGCAAACAAAGGAAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-258s1c1
Sequence:CCGGCGAAAGGTCTACTTGCAGCATCTCGAGATGCTGCAAGTAGACCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-938s1c1
Sequence:CCGGGCTCACCAAAGAATTATGAAACTCGAGTTTCATAATTCTTTGGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-1584s1c1
Sequence:CCGGGCGCCACATGACGACCAAGAACTCGAGTTCTTGGTCGTCATGTGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-201s1c1
Sequence:CCGGCGCAGTTGACATCATGGACATCTCGAGATGTCCATGATGTCAACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-811s21c1
Sequence:CCGGACACACCTCACGGACAGTTTACTCGAGTAAACTGTCCGTGAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1692s21c1
Sequence:CCGGCTCTGCCTGAAAGGTCCATTACTCGAGTAATGGACCTTTCAGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1232s21c1
Sequence:CCGGATGTCATGGCTGCCGGGAATACTCGAGTATTCCCGGCAGCCATGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1029s21c1
Sequence:CCGGGATCCCTGTGACTGGACAAAGCTCGAGCTTTGTCCAGTCACAGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-402s21c1
Sequence:CCGGTGTCACCACCACTGTGCATATCTCGAGATATGCACAGTGGTGGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2940s21c1
Sequence:CCGGACTGTATGAGCACGTAGATAACTCGAGTTATCTACGTGCTCATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1329s21c1
Sequence:CCGGCCGAAGGAGGAACTATGTTTGCTCGAGCAAACATAGTTCCTCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-462s21c1
Sequence:CCGGTTTATCGACTCTGTGCATAACCTCGAGGTTATGCACAGAGTCGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2618s21c1
Sequence:CCGGTGGCCTTATCCGTACTATATTCTCGAGAATATAGTACGGATAAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-351s21c1
Sequence:CCGGAGGTGACCTGTTGCGGATAAGCTCGAGCTTATCCGCAACAGGTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003597
VALIDATED
KLF11 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 11
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003597.4-2755s1c1
Sequence:CCGGCCGCTTCCTTTGTTTGCCAAACTCGAGTTTGGCAAACAAAGGAAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-258s1c1
Sequence:CCGGCGAAAGGTCTACTTGCAGCATCTCGAGATGCTGCAAGTAGACCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-938s1c1
Sequence:CCGGGCTCACCAAAGAATTATGAAACTCGAGTTTCATAATTCTTTGGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-1584s1c1
Sequence:CCGGGCGCCACATGACGACCAAGAACTCGAGTTCTTGGTCGTCATGTGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003597.4-201s1c1
Sequence:CCGGCGCAGTTGACATCATGGACATCTCGAGATGTCCATGATGTCAACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-811s21c1
Sequence:CCGGACACACCTCACGGACAGTTTACTCGAGTAAACTGTCCGTGAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1692s21c1
Sequence:CCGGCTCTGCCTGAAAGGTCCATTACTCGAGTAATGGACCTTTCAGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1232s21c1
Sequence:CCGGATGTCATGGCTGCCGGGAATACTCGAGTATTCCCGGCAGCCATGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1029s21c1
Sequence:CCGGGATCCCTGTGACTGGACAAAGCTCGAGCTTTGTCCAGTCACAGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-402s21c1
Sequence:CCGGTGTCACCACCACTGTGCATATCTCGAGATATGCACAGTGGTGGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2940s21c1
Sequence:CCGGACTGTATGAGCACGTAGATAACTCGAGTTATCTACGTGCTCATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-1329s21c1
Sequence:CCGGCCGAAGGAGGAACTATGTTTGCTCGAGCAAACATAGTTCCTCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-462s21c1
Sequence:CCGGTTTATCGACTCTGTGCATAACCTCGAGGTTATGCACAGAGTCGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-2618s21c1
Sequence:CCGGTGGCCTTATCCGTACTATATTCTCGAGAATATAGTACGGATAAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003597.4-351s21c1
Sequence:CCGGAGGTGACCTGTTGCGGATAAGCTCGAGCTTATCCGCAACAGGTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178357
KLF11 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178357.1-3518s1c1
Sequence:CCGGGCGACCGTGTAAGTGATAAATCTCGAGATTTATCACTTACACGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1301s1c1
Sequence:CCGGCCATTGGAAATACCAAGCTGTCTCGAGACAGCTTGGTATTTCCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1447s1c1
Sequence:CCGGTCCCACCTTAAAGCTCATCTTCTCGAGAAGATGAGCTTTAAGGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-303s1c1
Sequence:CCGGCATGGACATTTGTGAGTCGATCTCGAGATCGACTCACAAATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1015s1c1
Sequence:CCGGGAAAGTGACTTGTCAAGGAAACTCGAGTTTCCTTGACAAGTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178357
KLF11 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178357.1-3518s1c1
Sequence:CCGGGCGACCGTGTAAGTGATAAATCTCGAGATTTATCACTTACACGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1301s1c1
Sequence:CCGGCCATTGGAAATACCAAGCTGTCTCGAGACAGCTTGGTATTTCCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1447s1c1
Sequence:CCGGTCCCACCTTAAAGCTCATCTTCTCGAGAAGATGAGCTTTAAGGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-303s1c1
Sequence:CCGGCATGGACATTTGTGAGTCGATCTCGAGATCGACTCACAAATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1015s1c1
Sequence:CCGGGAAAGTGACTTGTCAAGGAAACTCGAGTTTCCTTGACAAGTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178357
KLF11 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178357.1-3518s1c1
Sequence:CCGGGCGACCGTGTAAGTGATAAATCTCGAGATTTATCACTTACACGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1301s1c1
Sequence:CCGGCCATTGGAAATACCAAGCTGTCTCGAGACAGCTTGGTATTTCCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1447s1c1
Sequence:CCGGTCCCACCTTAAAGCTCATCTTCTCGAGAAGATGAGCTTTAAGGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-303s1c1
Sequence:CCGGCATGGACATTTGTGAGTCGATCTCGAGATCGACTCACAAATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178357.1-1015s1c1
Sequence:CCGGGAAAGTGACTTGTCAAGGAAACTCGAGTTTCCTTGACAAGTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)