EMAIL THIS PAGE TO A FRIEND

KLF12

Kruppel-like factor 12

415 Gene Product Result for
Synonyms: AP-2rep AP2REP
UniProtKB ID: Q9Y4X4, A8K5T2, L0R3J4, Q5VZM7, Q9UHZ0
Gene ID:
Human(11278) Summary: Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16597) Kruppel-like factor 12
Rat(306110) Kruppel-like factor 12
chicken(418817) Kruppel-like factor 12
dog(485493) Kruppel-like factor 12
cow(100140477) Kruppel-like factor 12
Horse(100066348) Kruppel-like factor 12
domestic cat(101084926) Kruppel-like factor 12
domestic guinea pig(100730578) Kruppel-like factor 12
naked mole-rat(101721100) Kruppel-like factor 12
sheep(101122799) Kruppel-like factor 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007249 Rosetta Predictions human pricing
NM_016285 Rosetta Predictions human pricing
NM_001107281 Rosetta Predictions rat pricing
NM_010636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098857 predicted 342
2 SASI_Hs02_00343269 predicted 1453
3 SASI_Hs02_00343270 predicted 1283
4 SASI_Hs01_00098859 predicted 735
5 SASI_Hs02_00343271 predicted 1055
6 SASI_Hs02_00343272 predicted 956
7 SASI_Hs02_00343273 predicted 990
8 SASI_Hs02_00343274 predicted 906
9 SASI_Hs02_00343275 predicted 1461
10 SASI_Hs01_00098863 predicted 598
11 SASI_Hs01_00098858 predicted 646
12 SASI_Hs01_00098860 predicted 333
13 SASI_Hs01_00098861 predicted 360
14 SASI_Hs01_00098862 predicted 654
15 SASI_Hs01_00098864 predicted 713
16 SASI_Hs01_00098865 predicted 766
17 SASI_Hs01_00098866 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209586 predicted 326
2 SASI_Hs01_00209587 predicted 650
3 SASI_Hs01_00209588 predicted 711
4 SASI_Hs01_00209589 predicted 335
5 SASI_Hs01_00209590 predicted 365
6 SASI_Hs01_00209591 predicted 664
7 SASI_Hs01_00209592 predicted 580
8 SASI_Hs01_00209593 predicted 712
9 SASI_Hs01_00209594 predicted 764
10 SASI_Hs01_00209595 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107281 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227295 predicted 285
2 SASI_Rn02_00227296 predicted 943
3 SASI_Rn02_00227297 predicted 554
4 SASI_Rn02_00227298 predicted 679
5 SASI_Rn02_00227299 predicted 1065
6 SASI_Rn02_00227300 predicted 1248
7 SASI_Rn02_00227301 predicted 825
8 SASI_Rn02_00227302 predicted 694
9 SASI_Rn02_00227303 predicted 957
10 SASI_Rn02_00227304 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066257 predicted 866
2 SASI_Mm01_00066259 predicted 986
3 SASI_Mm01_00066260 predicted 411
4 SASI_Mm01_00066261 predicted 765
5 SASI_Mm01_00066262 predicted 537
6 SASI_Mm01_00066263 predicted 881
7 SASI_Mm01_00066264 predicted 1064
8 SASI_Mm01_00066266 predicted 560
9 SASI_Mm02_00318985 predicted 1090
10 SASI_Mm02_00318986 predicted 1148
11 SASI_Mm01_00066258 predicted 722
12 SASI_Mm01_00066265 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007249
VALIDATED
KLF12 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-462s21c1
Sequence:CCGGGCCAGTGGACTTGTCAATAAACTCGAGTTTATTGACAAGTCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-964s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-1164s21c1
Sequence:CCGGGCGTATCCACAGATGTGATTTCTCGAGAAATCACATCTGTGGATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-913s21c1
Sequence:GTACCGGCTATCTCCCAGACAAAGTAAACTCGAGTTTACTTTGTCTGGGAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-5841s21c1
Sequence:CCGGTATTAGGAAACCGGCTTATAACTCGAGTTATAAGCCGGTTTCCTAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007249.3-3191s1c1
Sequence:CCGGGCACATATTAACCTCACAATACTCGAGTATTGTGAGGTTAATATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-953s1c1
Sequence:CCGGGCGTTAATGAAACTGGATCTACTCGAGTAGATCCAGTTTCATTAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-330s1c1
Sequence:CCGGCGTCCACAACTATCCCGATATCTCGAGATATCGGGATAGTTGTGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1292s1c1
Sequence:CCGGCGAGGCATTACCGCAAACATACTCGAGTATGTTTGCGGTAATGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1063s1c1
Sequence:CCGGCCTTGTTCAATTTCACCATTTCTCGAGAAATGGTGAAATTGAACAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007249
VALIDATED
KLF12 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-462s21c1
Sequence:CCGGGCCAGTGGACTTGTCAATAAACTCGAGTTTATTGACAAGTCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-964s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-1164s21c1
Sequence:CCGGGCGTATCCACAGATGTGATTTCTCGAGAAATCACATCTGTGGATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-913s21c1
Sequence:GTACCGGCTATCTCCCAGACAAAGTAAACTCGAGTTTACTTTGTCTGGGAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-5841s21c1
Sequence:CCGGTATTAGGAAACCGGCTTATAACTCGAGTTATAAGCCGGTTTCCTAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007249.3-3191s1c1
Sequence:CCGGGCACATATTAACCTCACAATACTCGAGTATTGTGAGGTTAATATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-953s1c1
Sequence:CCGGGCGTTAATGAAACTGGATCTACTCGAGTAGATCCAGTTTCATTAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-330s1c1
Sequence:CCGGCGTCCACAACTATCCCGATATCTCGAGATATCGGGATAGTTGTGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1292s1c1
Sequence:CCGGCGAGGCATTACCGCAAACATACTCGAGTATGTTTGCGGTAATGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1063s1c1
Sequence:CCGGCCTTGTTCAATTTCACCATTTCTCGAGAAATGGTGAAATTGAACAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007249
VALIDATED
KLF12 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-462s21c1
Sequence:CCGGGCCAGTGGACTTGTCAATAAACTCGAGTTTATTGACAAGTCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-964s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-1164s21c1
Sequence:CCGGGCGTATCCACAGATGTGATTTCTCGAGAAATCACATCTGTGGATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-913s21c1
Sequence:GTACCGGCTATCTCCCAGACAAAGTAAACTCGAGTTTACTTTGTCTGGGAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_007249.4-5841s21c1
Sequence:CCGGTATTAGGAAACCGGCTTATAACTCGAGTTATAAGCCGGTTTCCTAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007249.3-3191s1c1
Sequence:CCGGGCACATATTAACCTCACAATACTCGAGTATTGTGAGGTTAATATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-953s1c1
Sequence:CCGGGCGTTAATGAAACTGGATCTACTCGAGTAGATCCAGTTTCATTAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_007249.3-330s1c1
Sequence:CCGGCGTCCACAACTATCCCGATATCTCGAGATATCGGGATAGTTGTGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1292s1c1
Sequence:CCGGCGAGGCATTACCGCAAACATACTCGAGTATGTTTGCGGTAATGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007249.3-1063s1c1
Sequence:CCGGCCTTGTTCAATTTCACCATTTCTCGAGAAATGGTGAAATTGAACAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010636
VALIDATED
KLF12 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-774s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-991s21c1
Sequence:CCGGACTTCGAAGGGTGCAACAAAGCTCGAGCTTTGTTGCACCCTTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-550s21c1
Sequence:GTACCGGTGAACTTACAGTCTAACAAACCTCGAGGTTTGTTAGACTGTAAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-5368s21c1
Sequence:CCGGACTAGAGAATCAGCTTATAATCTCGAGATTATAAGCTGATTCTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-855s21c1
Sequence:CCGGGTATCCAGGGTCCGAGGAAATCTCGAGATTTCCTCGGACCCTGGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-75s1c1
Sequence:CCGGGCCCTTGAGAACAGAATGCTACTCGAGTAGCATTCTGTTCTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010636.2-2911s1c1
Sequence:CCGGCCCAGCTTTCTGTGGCAAATTCTCGAGAATTTGCCACAGAAAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-866s1c1
Sequence:CCGGCCGAGGAAATCGAATGAATAACTCGAGTTATTCATTCGATTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-864s1c1
Sequence:CCGGGTCCGAGGAAATCGAATGAATCTCGAGATTCATTCGATTTCCTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010636.2-503s1c1
Sequence:CCGGCCAGCAGTTCTTGCACATCATCTCGAGATGATGTGCAAGAACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010636
VALIDATED
KLF12 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-774s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-991s21c1
Sequence:CCGGACTTCGAAGGGTGCAACAAAGCTCGAGCTTTGTTGCACCCTTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-550s21c1
Sequence:GTACCGGTGAACTTACAGTCTAACAAACCTCGAGGTTTGTTAGACTGTAAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-5368s21c1
Sequence:CCGGACTAGAGAATCAGCTTATAATCTCGAGATTATAAGCTGATTCTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-855s21c1
Sequence:CCGGGTATCCAGGGTCCGAGGAAATCTCGAGATTTCCTCGGACCCTGGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-75s1c1
Sequence:CCGGGCCCTTGAGAACAGAATGCTACTCGAGTAGCATTCTGTTCTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010636.2-2911s1c1
Sequence:CCGGCCCAGCTTTCTGTGGCAAATTCTCGAGAATTTGCCACAGAAAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-866s1c1
Sequence:CCGGCCGAGGAAATCGAATGAATAACTCGAGTTATTCATTCGATTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-864s1c1
Sequence:CCGGGTCCGAGGAAATCGAATGAATCTCGAGATTCATTCGATTTCCTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010636.2-503s1c1
Sequence:CCGGCCAGCAGTTCTTGCACATCATCTCGAGATGATGTGCAAGAACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010636
VALIDATED
KLF12 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-774s21c1
Sequence:CCGGGTGACCTTAGATAGCGTTAATCTCGAGATTAACGCTATCTAAGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-991s21c1
Sequence:CCGGACTTCGAAGGGTGCAACAAAGCTCGAGCTTTGTTGCACCCTTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-550s21c1
Sequence:GTACCGGTGAACTTACAGTCTAACAAACCTCGAGGTTTGTTAGACTGTAAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-5368s21c1
Sequence:CCGGACTAGAGAATCAGCTTATAATCTCGAGATTATAAGCTGATTCTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010636.3-855s21c1
Sequence:CCGGGTATCCAGGGTCCGAGGAAATCTCGAGATTTCCTCGGACCCTGGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-75s1c1
Sequence:CCGGGCCCTTGAGAACAGAATGCTACTCGAGTAGCATTCTGTTCTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010636.2-2911s1c1
Sequence:CCGGCCCAGCTTTCTGTGGCAAATTCTCGAGAATTTGCCACAGAAAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-866s1c1
Sequence:CCGGCCGAGGAAATCGAATGAATAACTCGAGTTATTCATTCGATTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010636.2-864s1c1
Sequence:CCGGGTCCGAGGAAATCGAATGAATCTCGAGATTCATTCGATTTCCTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010636.2-503s1c1
Sequence:CCGGCCAGCAGTTCTTGCACATCATCTCGAGATGATGTGCAAGAACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)