EMAIL THIS PAGE TO A FRIEND

KLF13

Kruppel-like factor 13

123 Gene Product Result for
Synonyms: BTEB3 FKLF2 NSLP1 RFLAT-1 RFLAT1
UniProtKB ID: Q9Y2Y9, Q9Y356
Gene ID:
Human(51621) Summary: KLF13 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]
Mouse(50794) Kruppel-like factor 13
Rat(499171) Kruppel-like factor 13
Zebrafish(767805) Kruppel-like factor 13
chicken(427493) Kruppel-like factor 13
dog(488698) Kruppel-like factor 13
cow(789710) Kruppel-like factor 13
sheep(101110272) Kruppel-like factor 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097931 MISSION® esiRNA esiRNA human KLF13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015995 Rosetta Predictions human pricing
NM_001109147 Rosetta Predictions rat pricing
NM_021366 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137161 predicted 1411
2 SASI_Hs01_00137162 predicted 1622
3 SASI_Hs01_00137163 predicted 855
4 SASI_Hs01_00137165 predicted 1451
5 SASI_Hs01_00137166 predicted 1501
6 SASI_Hs01_00137167 predicted 1395
7 SASI_Hs01_00137168 predicted 1494
8 SASI_Hs01_00137169 predicted 1449
9 SASI_Hs01_00137170 predicted 1386
10 SASI_Hs02_00348676 predicted 1276
11 SASI_Hs01_00137164 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245590 predicted 249
2 SASI_Rn02_00245591 predicted 353
3 SASI_Rn02_00245592 predicted 217
4 SASI_Rn02_00245593 predicted 216
5 SASI_Rn02_00245594 predicted 265
6 SASI_Rn02_00245595 predicted 336
7 SASI_Rn02_00245596 predicted 354
8 SASI_Rn02_00245597 predicted 283
9 SASI_Rn02_00245598 predicted 363
10 SASI_Rn02_00245599 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021366 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168539 predicted 870
2 SASI_Mm01_00168540 predicted 882
3 SASI_Mm01_00168541 predicted 881
4 SASI_Mm01_00168542 predicted 850
5 SASI_Mm01_00168543 predicted 870
6 SASI_Mm01_00168544 predicted 877
7 SASI_Mm01_00168545 predicted 864
8 SASI_Mm01_00168546 predicted 848
9 SASI_Mm01_00168547 predicted 501
10 SASI_Mm01_00168548 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015995
VALIDATED
KLF13 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-854s1c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015995.2-1080s1c1
Sequence:CCGGCGCCAACTTCCACCCGGGAATCTCGAGATTCCCGGGTGGAAGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-535s1c1
Sequence:CCGGCTAGCGGACCTCAACCAGCAACTCGAGTTGCTGGTTGAGGTCCGCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-998s1c1
Sequence:CCGGCGGGCGAGAAGAAGTTCAGCTCTCGAGAGCTGAACTTCTTCTCGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-867s1c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1498s21c1
Sequence:CCGGCCTTACTCTGTACATAGATTTCTCGAGAAATCTATGTACAGAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-825s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1387s21c1
Sequence:CCGGACCAAATTGCACAATAGATACCTCGAGGTATCTATTGTGCAATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-854s21c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-867s21c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015995
VALIDATED
KLF13 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-854s1c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015995.2-1080s1c1
Sequence:CCGGCGCCAACTTCCACCCGGGAATCTCGAGATTCCCGGGTGGAAGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-535s1c1
Sequence:CCGGCTAGCGGACCTCAACCAGCAACTCGAGTTGCTGGTTGAGGTCCGCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-998s1c1
Sequence:CCGGCGGGCGAGAAGAAGTTCAGCTCTCGAGAGCTGAACTTCTTCTCGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-867s1c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1498s21c1
Sequence:CCGGCCTTACTCTGTACATAGATTTCTCGAGAAATCTATGTACAGAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-825s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1387s21c1
Sequence:CCGGACCAAATTGCACAATAGATACCTCGAGGTATCTATTGTGCAATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-854s21c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-867s21c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015995
VALIDATED
KLF13 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-854s1c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015995.2-1080s1c1
Sequence:CCGGCGCCAACTTCCACCCGGGAATCTCGAGATTCCCGGGTGGAAGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-535s1c1
Sequence:CCGGCTAGCGGACCTCAACCAGCAACTCGAGTTGCTGGTTGAGGTCCGCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-998s1c1
Sequence:CCGGCGGGCGAGAAGAAGTTCAGCTCTCGAGAGCTGAACTTCTTCTCGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015995.2-867s1c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1498s21c1
Sequence:CCGGCCTTACTCTGTACATAGATTTCTCGAGAAATCTATGTACAGAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-825s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-1387s21c1
Sequence:CCGGACCAAATTGCACAATAGATACCTCGAGGTATCTATTGTGCAATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-854s21c1
Sequence:CCGGGCGAGAAAGTTTACGGGAAATCTCGAGATTTCCCGTAAACTTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_015995.2-867s21c1
Sequence:CCGGCGGGAAATCTTCGCACCTCAACTCGAGTTGAGGTGCGAAGATTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021366
VALIDATED
KLF13 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-508s1c1
Sequence:CCGGGCAAGGACAGCGCCTCGCTTTCTCGAGAAAGCGAGGCGCTGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-961s1c1
Sequence:CCGGGCAACAAGAAGTTCGCACGCTCTCGAGAGCGTGCGAACTTCTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-1158s1c1
Sequence:CCGGAGCGACTACAGCCGCTCCGATCTCGAGATCGGAGCGGCTGTAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-382s1c1
Sequence:CCGGCCGAGTGCCTCGTGTCCATGTCTCGAGACATGGACACGAGGCACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-874s1c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-874s21c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-898s21c1
Sequence:CCGGACCTCAAGGCGCACCTGAGAACTCGAGTTCTCAGGTGCGCCTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-842s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1013s21c1
Sequence:CCGGCACGGGCGAGAAGAAGTTCAGCTCGAGCTGAACTTCTTCTCGCCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1041s21c1
Sequence:CCGGATCTGTGAGAAGCGCTTCATGCTCGAGCATGAAGCGCTTCTCACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021366
VALIDATED
KLF13 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-508s1c1
Sequence:CCGGGCAAGGACAGCGCCTCGCTTTCTCGAGAAAGCGAGGCGCTGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-961s1c1
Sequence:CCGGGCAACAAGAAGTTCGCACGCTCTCGAGAGCGTGCGAACTTCTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-1158s1c1
Sequence:CCGGAGCGACTACAGCCGCTCCGATCTCGAGATCGGAGCGGCTGTAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-382s1c1
Sequence:CCGGCCGAGTGCCTCGTGTCCATGTCTCGAGACATGGACACGAGGCACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-874s1c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-874s21c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-898s21c1
Sequence:CCGGACCTCAAGGCGCACCTGAGAACTCGAGTTCTCAGGTGCGCCTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-842s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1013s21c1
Sequence:CCGGCACGGGCGAGAAGAAGTTCAGCTCGAGCTGAACTTCTTCTCGCCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1041s21c1
Sequence:CCGGATCTGTGAGAAGCGCTTCATGCTCGAGCATGAAGCGCTTCTCACAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021366
VALIDATED
KLF13 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-508s1c1
Sequence:CCGGGCAAGGACAGCGCCTCGCTTTCTCGAGAAAGCGAGGCGCTGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-961s1c1
Sequence:CCGGGCAACAAGAAGTTCGCACGCTCTCGAGAGCGTGCGAACTTCTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021366.2-1158s1c1
Sequence:CCGGAGCGACTACAGCCGCTCCGATCTCGAGATCGGAGCGGCTGTAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-382s1c1
Sequence:CCGGCCGAGTGCCTCGTGTCCATGTCTCGAGACATGGACACGAGGCACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021366.2-874s1c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-874s21c1
Sequence:CCGGAGAAAGTTTACGGGAAATCTTCTCGAGAAGATTTCCCGTAAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021366.2-898s21c1
Sequence:CCGGACCTCAAGGCGCACCTGAGAACTCGAGTTCTCAGGTGCGCCTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-842s21c1
Sequence:CCGGGAGGAAGCACAAGTGCCACTACTCGAGTAGTGGCACTTGTGCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1013s21c1
Sequence:CCGGCACGGGCGAGAAGAAGTTCAGCTCGAGCTGAACTTCTTCTCGCCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021366.2-1041s21c1
Sequence:CCGGATCTGTGAGAAGCGCTTCATGCTCGAGCATGAAGCGCTTCTCACAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)