EMAIL THIS PAGE TO A FRIEND

KLF14

Kruppel-like factor 14

82 Gene Product Result for
Synonyms: BTEB5
UniProtKB ID: Q8TD94, Q19A42, Q19A43
Gene ID:
Human(136259) Summary: This gene encodes a member of the Kruppel-like family of transcription factors. The gene exhibits imprinted expression from the maternal allele in embryonic and extra-embryonic tissues. Expression of this gene is induced by TGF-beta, and the protein represses TGF-beta receptor II expression. The protein functions as part of a transcriptional co-repressor complex that also contains the transcriptional regulator SIN3A and histone deacetylase 2. [provided by RefSeq, Nov 2009]
Mouse(619665) Kruppel-like factor 14
Rat(312203) Kruppel-like factor 14
domestic guinea pig(100727151) Kruppel-like factor 14
naked mole-rat(101717356) Kruppel-like factor 14
dog(482254) Kruppel-like factor 14
cow(785436) Kruppel-like factor 14
domestic cat(101093674) Kruppel-like factor 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001476241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001476241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001476241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138693 Rosetta Predictions human pricing
XM_001476241 Rosetta Predictions mouse pricing
XM_884028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168202 predicted 980
2 SASI_Hs01_00168203 predicted 961
3 SASI_Hs02_00363787 predicted 1015
4 SASI_Hs01_00168204 predicted 604
5 SASI_Hs01_00168206 predicted 895
6 SASI_Hs01_00168207 predicted 1151
7 SASI_Hs01_00168208 predicted 964
8 SASI_Hs01_00168209 predicted 981
9 SASI_Hs01_00168210 predicted 972
10 SASI_Hs02_00363788 predicted 828
11 SASI_Hs01_00168205 predicted 1062
12 SASI_Hs01_00168211 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00387785 predicted 594
2 SASI_Mm02_00387786 predicted 980
3 SASI_Mm02_00387787 predicted 880
4 SASI_Mm02_00387788 predicted 957
5 SASI_Mm02_00387789 predicted 1037
6 SASI_Mm02_00387790 predicted 719
7 SASI_Mm02_00387791 predicted 821
8 SASI_Mm02_00387792 predicted 982
9 SASI_Mm02_00387793 predicted 878
10 SASI_Mm02_00387794 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274898 predicted 598
2 SASI_Mm01_00274900 predicted 980
3 SASI_Mm01_00274901 predicted 887
4 SASI_Mm01_00274903 predicted 962
5 SASI_Mm02_00428066 predicted 1037
6 SASI_Mm02_00428067 predicted 713
7 SASI_Mm02_00428068 predicted 826
8 SASI_Mm01_00274904 predicted 981
9 SASI_Mm01_00274906 predicted 877
10 SASI_Mm01_00274907 predicted 998
11 SASI_Mm01_00274899 predicted 973
12 SASI_Mm01_00274902 predicted 1092
13 SASI_Mm01_00274905 predicted 934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138693
KLF14 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 14
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-255s1c1
Sequence:CCGGTGCAAGCGTCTGGGCGGACTTCTCGAGAAGTCCGCCCAGACGCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138693.1-1166s1c1
Sequence:CCGGGCAACGTGTATATCATCCTAACTCGAGTTAGGATGATATACACGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-840s1c1
Sequence:CCGGTCATCCAGATATGATCGAGTACTCGAGTACTCGATCATATCTGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-831s1c1
Sequence:CCGGCCCAACCTATCATCCAGATATCTCGAGATATCTGGATGATAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-695s1c1
Sequence:CCGGGCGACAAGAAGTTTACGCGTTCTCGAGAACGCGTAAACTTCTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138693
KLF14 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 14
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-255s1c1
Sequence:CCGGTGCAAGCGTCTGGGCGGACTTCTCGAGAAGTCCGCCCAGACGCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138693.1-1166s1c1
Sequence:CCGGGCAACGTGTATATCATCCTAACTCGAGTTAGGATGATATACACGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-840s1c1
Sequence:CCGGTCATCCAGATATGATCGAGTACTCGAGTACTCGATCATATCTGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-831s1c1
Sequence:CCGGCCCAACCTATCATCCAGATATCTCGAGATATCTGGATGATAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-695s1c1
Sequence:CCGGGCGACAAGAAGTTTACGCGTTCTCGAGAACGCGTAAACTTCTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138693
KLF14 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 14
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-255s1c1
Sequence:CCGGTGCAAGCGTCTGGGCGGACTTCTCGAGAAGTCCGCCCAGACGCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138693.1-1166s1c1
Sequence:CCGGGCAACGTGTATATCATCCTAACTCGAGTTAGGATGATATACACGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-840s1c1
Sequence:CCGGTCATCCAGATATGATCGAGTACTCGAGTACTCGATCATATCTGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-831s1c1
Sequence:CCGGCCCAACCTATCATCCAGATATCTCGAGATATCTGGATGATAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138693.1-695s1c1
Sequence:CCGGGCGACAAGAAGTTTACGCGTTCTCGAGAACGCGTAAACTTCTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001476241
KLF14 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-542s21c1
Sequence:CCGGCGAGCGCTTTGGCTGATTTAACTCGAGTTAAATCAGCCAAAGCGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-831s21c1
Sequence:CCGGGTACCGAAGGAGGCAGATTACCTCGAGGTAATCTGCCTCCTTCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-1118s21c1
Sequence:CCGGCAACTTACCATCCCGACATGACTCGAGTCATGTCGGGATGGTAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-974s21c1
Sequence:CCGGTCGACTGCGACAAGAAGTTTACTCGAGTAAACTTCTTGTCGCAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-583s21c1
Sequence:CCGGTTCAGGGAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTCCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001476241
KLF14 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-542s21c1
Sequence:CCGGCGAGCGCTTTGGCTGATTTAACTCGAGTTAAATCAGCCAAAGCGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-831s21c1
Sequence:CCGGGTACCGAAGGAGGCAGATTACCTCGAGGTAATCTGCCTCCTTCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-1118s21c1
Sequence:CCGGCAACTTACCATCCCGACATGACTCGAGTCATGTCGGGATGGTAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-974s21c1
Sequence:CCGGTCGACTGCGACAAGAAGTTTACTCGAGTAAACTTCTTGTCGCAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-583s21c1
Sequence:CCGGTTCAGGGAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTCCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001476241
KLF14 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-542s21c1
Sequence:CCGGCGAGCGCTTTGGCTGATTTAACTCGAGTTAAATCAGCCAAAGCGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-831s21c1
Sequence:CCGGGTACCGAAGGAGGCAGATTACCTCGAGGTAATCTGCCTCCTTCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-1118s21c1
Sequence:CCGGCAACTTACCATCCCGACATGACTCGAGTCATGTCGGGATGGTAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-974s21c1
Sequence:CCGGTCGACTGCGACAAGAAGTTTACTCGAGTAAACTTCTTGTCGCAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001476241.1-583s21c1
Sequence:CCGGTTCAGGGAAGACTCCGAAGAACTCGAGTTCTTCGGAGTCTTCCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)