EMAIL THIS PAGE TO A FRIEND

KLF15

Kruppel-like factor 15

86 Gene Product Result for
Synonyms: KKLF
UniProtKB ID: Q9UIH9
Gene ID:
Mouse(66277) Kruppel-like factor 15
Rat(85497) Kruppel-like factor 15
Zebrafish(335901) Kruppel-like factor 15
cow(407241) Kruppel-like factor 15
domestic cat(101093841) Kruppel-like factor 15
dog(609067) Kruppel-like factor 15
chicken(427588) Kruppel-like factor 15
sheep(101115319) Kruppel-like factor 15
domestic guinea pig(100729933) Kruppel-like factor 15
naked mole-rat(101707608) Kruppel-like factor 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023184 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023184 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023184 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014079 Rosetta Predictions human pricing
NM_053536 Rosetta Predictions rat pricing
NM_023184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099381 predicted 1334
2 SASI_Hs01_00099383 predicted 708
3 SASI_Hs01_00099384 predicted 983
4 SASI_Hs01_00099385 predicted 1601
5 SASI_Hs01_00099386 predicted 1317
6 SASI_Hs01_00099387 predicted 540
7 SASI_Hs01_00099388 predicted 555
8 SASI_Hs01_00099389 predicted 1013
9 SASI_Hs01_00099390 predicted 1096
10 SASI_Hs02_00345108 predicted 1730
11 SASI_Hs01_00099382 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038992 predicted 610
2 SASI_Rn01_00038993 predicted 1576
3 SASI_Rn01_00038994 predicted 1590
4 SASI_Rn01_00038995 predicted 366
5 SASI_Rn01_00038996 predicted 1094
6 SASI_Rn01_00038997 predicted 1582
7 SASI_Rn02_00266154 predicted 493
8 SASI_Rn02_00266155 predicted 1077
9 SASI_Rn01_00039000 predicted 1065
10 SASI_Rn01_00039001 predicted 620
11 SASI_Rn01_00038998 predicted 2030
12 SASI_Rn01_00038999 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138081 predicted 1868
2 SASI_Mm01_00138083 predicted 456
3 SASI_Mm01_00138084 predicted 1419
4 SASI_Mm01_00138085 predicted 1803
5 SASI_Mm02_00326907 predicted 1491
6 SASI_Mm01_00138087 predicted 1208
7 SASI_Mm01_00138088 predicted 1313
8 SASI_Mm01_00138089 predicted 915
9 SASI_Mm01_00138090 predicted 1279
10 SASI_Mm02_00326908 predicted 1742
11 SASI_Mm01_00138082 predicted 952
12 SASI_Mm01_00138086 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014079
KLF15 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-610s21c1
Sequence:CCGGCTACCCTGGAGGAGATTGAAGCTCGAGCTTCAATCTCCTCCAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014079.2-2359s21c1
Sequence:GTACCGGACATAGGTCCATCCACATAAACTCGAGTTTATGTGGATGGACCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1009s21c1
Sequence:CCGGTGAACCTGCCCTCCAAGTTTGCTCGAGCAAACTTGGAGGGCAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-1310s1c1
Sequence:CCGGGCGCTCGCACTCAGGTGTGAACTCGAGTTCACACCTGAGTGCGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-248s21c1
Sequence:CCGGAGTTGGGTATCTGGGTGATAGCTCGAGCTATCACCCAGATACCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1131s21c1
Sequence:CCGGCCAGCCGCAGAACTCATCAAACTCGAGTTTGATGAGTTCTGCGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-247s1c1
Sequence:CCGGCAGTTGGGTATCTGGGTGATACTCGAGTATCACCCAGATACCCAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-309s1c1
Sequence:CCGGGTCTCTGAAGATGACAGCGATCTCGAGATCGCTGTCATCTTCAGAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-615s1c1
Sequence:CCGGCTGGAGGAGATTGAAGAGTTTCTCGAGAAACTCTTCAATCTCCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-561s1c1
Sequence:CCGGCCCGAGTTTCCTTTGGGTGATCTCGAGATCACCCAAAGGAAACTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014079
KLF15 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-610s21c1
Sequence:CCGGCTACCCTGGAGGAGATTGAAGCTCGAGCTTCAATCTCCTCCAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014079.2-2359s21c1
Sequence:GTACCGGACATAGGTCCATCCACATAAACTCGAGTTTATGTGGATGGACCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1009s21c1
Sequence:CCGGTGAACCTGCCCTCCAAGTTTGCTCGAGCAAACTTGGAGGGCAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-1310s1c1
Sequence:CCGGGCGCTCGCACTCAGGTGTGAACTCGAGTTCACACCTGAGTGCGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-248s21c1
Sequence:CCGGAGTTGGGTATCTGGGTGATAGCTCGAGCTATCACCCAGATACCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1131s21c1
Sequence:CCGGCCAGCCGCAGAACTCATCAAACTCGAGTTTGATGAGTTCTGCGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-247s1c1
Sequence:CCGGCAGTTGGGTATCTGGGTGATACTCGAGTATCACCCAGATACCCAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-309s1c1
Sequence:CCGGGTCTCTGAAGATGACAGCGATCTCGAGATCGCTGTCATCTTCAGAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-615s1c1
Sequence:CCGGCTGGAGGAGATTGAAGAGTTTCTCGAGAAACTCTTCAATCTCCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-561s1c1
Sequence:CCGGCCCGAGTTTCCTTTGGGTGATCTCGAGATCACCCAAAGGAAACTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014079
KLF15 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-610s21c1
Sequence:CCGGCTACCCTGGAGGAGATTGAAGCTCGAGCTTCAATCTCCTCCAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014079.2-2359s21c1
Sequence:GTACCGGACATAGGTCCATCCACATAAACTCGAGTTTATGTGGATGGACCTATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1009s21c1
Sequence:CCGGTGAACCTGCCCTCCAAGTTTGCTCGAGCAAACTTGGAGGGCAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-1310s1c1
Sequence:CCGGGCGCTCGCACTCAGGTGTGAACTCGAGTTCACACCTGAGTGCGAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-248s21c1
Sequence:CCGGAGTTGGGTATCTGGGTGATAGCTCGAGCTATCACCCAGATACCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014079.2-1131s21c1
Sequence:CCGGCCAGCCGCAGAACTCATCAAACTCGAGTTTGATGAGTTCTGCGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-247s1c1
Sequence:CCGGCAGTTGGGTATCTGGGTGATACTCGAGTATCACCCAGATACCCAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-309s1c1
Sequence:CCGGGTCTCTGAAGATGACAGCGATCTCGAGATCGCTGTCATCTTCAGAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-615s1c1
Sequence:CCGGCTGGAGGAGATTGAAGAGTTTCTCGAGAAACTCTTCAATCTCCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014079.2-561s1c1
Sequence:CCGGCCCGAGTTTCCTTTGGGTGATCTCGAGATCACCCAAAGGAAACTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023184
VALIDATED
KLF15 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-945s1c1
Sequence:CCGGCCCTCAAAGTTTGTGCGAATTCTCGAGAATTCGCACAAACTTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-985s1c1
Sequence:CCGGCCAAACCTATTGGCTCAGGATCTCGAGATCCTGAGCCAATAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-477s1c1
Sequence:CCGGCATTTCTGCTTCCCTGAATTTCTCGAGAAATTCAGGGAAGCAGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-167s1c1
Sequence:CCGGACCGAAATGCTCAGTGGGTTACTCGAGTAACCCACTGAGCATTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-1238s1c1
Sequence:CCGGGCGATCTCACTCGGGTGTGAACTCGAGTTCACACCCGAGTGAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023184
VALIDATED
KLF15 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-945s1c1
Sequence:CCGGCCCTCAAAGTTTGTGCGAATTCTCGAGAATTCGCACAAACTTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-985s1c1
Sequence:CCGGCCAAACCTATTGGCTCAGGATCTCGAGATCCTGAGCCAATAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-477s1c1
Sequence:CCGGCATTTCTGCTTCCCTGAATTTCTCGAGAAATTCAGGGAAGCAGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-167s1c1
Sequence:CCGGACCGAAATGCTCAGTGGGTTACTCGAGTAACCCACTGAGCATTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-1238s1c1
Sequence:CCGGGCGATCTCACTCGGGTGTGAACTCGAGTTCACACCCGAGTGAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023184
VALIDATED
KLF15 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-945s1c1
Sequence:CCGGCCCTCAAAGTTTGTGCGAATTCTCGAGAATTCGCACAAACTTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-985s1c1
Sequence:CCGGCCAAACCTATTGGCTCAGGATCTCGAGATCCTGAGCCAATAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023184.2-477s1c1
Sequence:CCGGCATTTCTGCTTCCCTGAATTTCTCGAGAAATTCAGGGAAGCAGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-167s1c1
Sequence:CCGGACCGAAATGCTCAGTGGGTTACTCGAGTAACCCACTGAGCATTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_023184.2-1238s1c1
Sequence:CCGGGCGATCTCACTCGGGTGTGAACTCGAGTTCACACCCGAGTGAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)