EMAIL THIS PAGE TO A FRIEND

KLF16

Kruppel-like factor 16

62 Gene Product Result for
Synonyms: BTEB4 DRRF NSLP2
UniProtKB ID: Q9BXK1
Gene ID:
Mouse(118445) Kruppel-like factor 16
Rat(690820) Kruppel-like factor 16
naked mole-rat(101722050) Kruppel-like factor 16
cow(519163) Kruppel-like factor 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_078477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_078477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_078477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009591 MISSION® esiRNA esiRNA targeting mouse Klf16 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031918 Rosetta Predictions human pricing
NM_001127604 Rosetta Predictions rat pricing
NM_078477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032120 predicted 636
2 SASI_Hs01_00032121 predicted 476
3 SASI_Hs02_00359048 predicted 1047
4 SASI_Hs02_00359049 predicted 2514
5 SASI_Hs01_00032122 predicted 1711
6 SASI_Hs01_00032123 predicted 1689
7 SASI_Hs01_00032125 predicted 1556
8 SASI_Hs02_00359050 predicted 1513
9 SASI_Hs01_00032126 predicted 2752
10 SASI_Hs01_00032127 predicted 1358
11 SASI_Hs01_00032119 predicted 1226
12 SASI_Hs01_00032124 predicted 2651
13 SASI_Hs01_00032128 predicted 2537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254630 predicted 551
2 SASI_Rn02_00254631 predicted 475
3 SASI_Rn02_00254632 predicted 880
4 SASI_Rn02_00254633 predicted 876
5 SASI_Rn02_00254634 predicted 926
6 SASI_Rn02_00254635 predicted 1005
7 SASI_Rn02_00254636 predicted 569
8 SASI_Rn02_00254637 predicted 927
9 SASI_Rn02_00254638 predicted 1202
10 SASI_Rn02_00254639 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081144 predicted 490
2 SASI_Mm01_00081140 predicted 1024
3 SASI_Mm01_00081146 predicted 589
4 SASI_Mm01_00081142 predicted 334
5 SASI_Mm01_00081141 predicted 1034
6 SASI_Mm01_00081145 predicted 944
7 SASI_Mm01_00081147 predicted 1214
8 SASI_Mm01_00081143 predicted 332
9 SASI_Mm01_00081149 predicted 585
10 SASI_Mm02_00338068 predicted 1275
11 SASI_Mm01_00081148 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031918
VALIDATED
KLF16 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 16
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-468s21c1
Sequence:CCGGTGCGCCAAAGCCTACTACAAGCTCGAGCTTGTAGTAGGCTTTGGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-553s21c1
Sequence:CCGGAGGGCTGCGACAAGAAGTTCGCTCGAGCGAACTTCTTGTCGCAGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-1034s21c1
Sequence:CCGGTGTGTCTGTAAATAGCCATGACTCGAGTCATGGCTATTTACAGACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-919s21c1
Sequence:CCGGGTGGGCAAACCCTGAAGACACCTCGAGGTGTCTTCAGGGTTTGCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-414s1c1
Sequence:CCGGCTACAAGTCCTCGCACCTAAACTCGAGTTTAGGTGCGAGGACTTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-423s1c1
Sequence:CCGGCTCGCACCTAAAGTCGCACCTCTCGAGAGGTGCGACTTTAGGTGCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-567s1c1
Sequence:CCGGCCCTCTGTGCTCCAAGCGCTTCTCGAGAAGCGCTTGGAGCACAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-41s1c1
Sequence:CCGGACGTGCTCATGGCCATCTCTTCTCGAGAAGAGATGGCCATGAGCACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-579s1c1
Sequence:CCGGCAAGCGCTTCACCCGCAGTGACTCGAGTCACTGCGGGTGAAGCGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031918
VALIDATED
KLF16 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 16
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-468s21c1
Sequence:CCGGTGCGCCAAAGCCTACTACAAGCTCGAGCTTGTAGTAGGCTTTGGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-553s21c1
Sequence:CCGGAGGGCTGCGACAAGAAGTTCGCTCGAGCGAACTTCTTGTCGCAGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-1034s21c1
Sequence:CCGGTGTGTCTGTAAATAGCCATGACTCGAGTCATGGCTATTTACAGACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-919s21c1
Sequence:CCGGGTGGGCAAACCCTGAAGACACCTCGAGGTGTCTTCAGGGTTTGCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-414s1c1
Sequence:CCGGCTACAAGTCCTCGCACCTAAACTCGAGTTTAGGTGCGAGGACTTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-423s1c1
Sequence:CCGGCTCGCACCTAAAGTCGCACCTCTCGAGAGGTGCGACTTTAGGTGCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-567s1c1
Sequence:CCGGCCCTCTGTGCTCCAAGCGCTTCTCGAGAAGCGCTTGGAGCACAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-41s1c1
Sequence:CCGGACGTGCTCATGGCCATCTCTTCTCGAGAAGAGATGGCCATGAGCACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-579s1c1
Sequence:CCGGCAAGCGCTTCACCCGCAGTGACTCGAGTCACTGCGGGTGAAGCGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031918
VALIDATED
KLF16 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 16
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-468s21c1
Sequence:CCGGTGCGCCAAAGCCTACTACAAGCTCGAGCTTGTAGTAGGCTTTGGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031918.3-553s21c1
Sequence:CCGGAGGGCTGCGACAAGAAGTTCGCTCGAGCGAACTTCTTGTCGCAGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-1034s21c1
Sequence:CCGGTGTGTCTGTAAATAGCCATGACTCGAGTCATGGCTATTTACAGACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031918.3-919s21c1
Sequence:CCGGGTGGGCAAACCCTGAAGACACCTCGAGGTGTCTTCAGGGTTTGCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-414s1c1
Sequence:CCGGCTACAAGTCCTCGCACCTAAACTCGAGTTTAGGTGCGAGGACTTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-423s1c1
Sequence:CCGGCTCGCACCTAAAGTCGCACCTCTCGAGAGGTGCGACTTTAGGTGCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-567s1c1
Sequence:CCGGCCCTCTGTGCTCCAAGCGCTTCTCGAGAAGCGCTTGGAGCACAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031918.1-41s1c1
Sequence:CCGGACGTGCTCATGGCCATCTCTTCTCGAGAAGAGATGGCCATGAGCACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_031918.1-579s1c1
Sequence:CCGGCAAGCGCTTCACCCGCAGTGACTCGAGTCACTGCGGGTGAAGCGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078477
VALIDATED
KLF16 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 16
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078477.2-2472s21c1
Sequence:GTACCGGACTTCAGGTTCTGATTGATAACTCGAGTTATCAATCAGAACCTGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-662s21c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-586s21c1
Sequence:CCGGGACAAGAAGTTCGCCCGTTCTCTCGAGAGAACGGGCGAACTTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-489s21c1
Sequence:CCGGTGGCTGCGCCAAAGCCTATTACTCGAGTAATAGGCTTTGGCGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-833s21c1
Sequence:CCGGCAGCTCCTGCTGGCTTGTAGACTCGAGTCTACAAGCCAGCAGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078477.1-1023s1c1
Sequence:CCGGCCTCAGGTTCTGTCTGTAAATCTCGAGATTTACAGACAGAACCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-495s1c1
Sequence:CCGGCCAAAGCCTATTACAAGTCTTCTCGAGAAGACTTGTAATAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-490s1c1
Sequence:CCGGGTGCGCCAAAGCCTATTACAACTCGAGTTGTAATAGGCTTTGGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-582s1c1
Sequence:CCGGGTGACAAGAAGTTCGCCCGTTCTCGAGAACGGGCGAACTTCTTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-660s1c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078477
VALIDATED
KLF16 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 16
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078477.2-2472s21c1
Sequence:GTACCGGACTTCAGGTTCTGATTGATAACTCGAGTTATCAATCAGAACCTGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-662s21c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-586s21c1
Sequence:CCGGGACAAGAAGTTCGCCCGTTCTCTCGAGAGAACGGGCGAACTTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-489s21c1
Sequence:CCGGTGGCTGCGCCAAAGCCTATTACTCGAGTAATAGGCTTTGGCGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-833s21c1
Sequence:CCGGCAGCTCCTGCTGGCTTGTAGACTCGAGTCTACAAGCCAGCAGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078477.1-1023s1c1
Sequence:CCGGCCTCAGGTTCTGTCTGTAAATCTCGAGATTTACAGACAGAACCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-495s1c1
Sequence:CCGGCCAAAGCCTATTACAAGTCTTCTCGAGAAGACTTGTAATAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-490s1c1
Sequence:CCGGGTGCGCCAAAGCCTATTACAACTCGAGTTGTAATAGGCTTTGGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-582s1c1
Sequence:CCGGGTGACAAGAAGTTCGCCCGTTCTCGAGAACGGGCGAACTTCTTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-660s1c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078477
VALIDATED
KLF16 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 16
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_078477.2-2472s21c1
Sequence:GTACCGGACTTCAGGTTCTGATTGATAACTCGAGTTATCAATCAGAACCTGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-662s21c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-586s21c1
Sequence:CCGGGACAAGAAGTTCGCCCGTTCTCTCGAGAGAACGGGCGAACTTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-489s21c1
Sequence:CCGGTGGCTGCGCCAAAGCCTATTACTCGAGTAATAGGCTTTGGCGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078477.2-833s21c1
Sequence:CCGGCAGCTCCTGCTGGCTTGTAGACTCGAGTCTACAAGCCAGCAGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078477.1-1023s1c1
Sequence:CCGGCCTCAGGTTCTGTCTGTAAATCTCGAGATTTACAGACAGAACCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-495s1c1
Sequence:CCGGCCAAAGCCTATTACAAGTCTTCTCGAGAAGACTTGTAATAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-490s1c1
Sequence:CCGGGTGCGCCAAAGCCTATTACAACTCGAGTTGTAATAGGCTTTGGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_078477.1-582s1c1
Sequence:CCGGGTGACAAGAAGTTCGCCCGTTCTCGAGAACGGGCGAACTTCTTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_078477.1-660s1c1
Sequence:CCGGCCCTGTGTACCAAGCGGTTCACTCGAGTGAACCGCTTGGTACACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)