EMAIL THIS PAGE TO A FRIEND

KLF17

Kruppel-like factor 17

122 Gene Product Result for
Synonyms: ZNF393 Zfp393
UniProtKB ID: Q5JT82, Q86VQ7, Q8N805
Gene ID:
Mouse(75753) Kruppel-like factor 17
Rat(298449) Kruppel-like factor 17
cow(516413) Kruppel-like factor 17
domestic cat(101085484) Kruppel-like factor 17
sheep(101108444) Kruppel-like factor 17
domestic guinea pig(100725519) Kruppel-like factor 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173484 Rosetta Predictions human pricing
XM_001072022 Rosetta Predictions rat pricing
XM_233437 Rosetta Predictions rat pricing
NM_029416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203104 predicted 225
2 SASI_Hs01_00203105 predicted 1068
3 SASI_Hs01_00203106 predicted 1050
4 SASI_Hs01_00203108 predicted 1065
5 SASI_Hs01_00203109 predicted 1003
6 SASI_Hs02_00368242 predicted 598
7 SASI_Hs01_00203111 predicted 1085
8 SASI_Hs02_00368243 predicted 1300
9 SASI_Hs02_00368244 predicted 697
10 SASI_Hs02_00368245 predicted 1035
11 SASI_Hs01_00203107 predicted 232
12 SASI_Hs01_00203110 predicted 391
13 SASI_Hs01_00203112 predicted 313
14 SASI_Hs01_00203113 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337444 predicted 769
2 SASI_Rn02_00337445 predicted 395
3 SASI_Rn02_00337446 predicted 754
4 SASI_Rn02_00337447 predicted 763
5 SASI_Rn02_00337448 predicted 378
6 SASI_Rn02_00337449 predicted 652
7 SASI_Rn02_00337450 predicted 323
8 SASI_Rn02_00337451 predicted 647
9 SASI_Rn02_00337452 predicted 554
10 SASI_Rn02_00337453 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154416 predicted 764
2 SASI_Rn01_00154417 predicted 402
3 SASI_Rn01_00154418 predicted 750
4 SASI_Rn01_00154419 predicted 766
5 SASI_Rn01_00154420 predicted 381
6 SASI_Rn01_00154421 predicted 653
7 SASI_Rn02_00387782 predicted 325
8 SASI_Rn01_00154423 predicted 654
9 SASI_Rn01_00154424 predicted 555
10 SASI_Rn02_00387783 predicted 345
11 SASI_Rn01_00154422 predicted 704
12 SASI_Rn01_00154425 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120300 predicted 863
2 SASI_Mm01_00120301 predicted 1237
3 SASI_Mm01_00120302 predicted 987
4 SASI_Mm01_00120303 predicted 878
5 SASI_Mm01_00120304 predicted 442
6 SASI_Mm01_00120305 predicted 1243
7 SASI_Mm01_00120306 predicted 1015
8 SASI_Mm02_00335309 predicted 676
9 SASI_Mm01_00120309 predicted 1079
10 SASI_Mm02_00335310 predicted 754
11 SASI_Mm01_00120307 predicted 375
12 SASI_Mm01_00120308 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173484
KLF17 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173484.2-1294s1c1
Sequence:CCGGGCAGTCTTCAAGTTCTACATTCTCGAGAATGTAGAACTTGAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-159s1c1
Sequence:CCGGCCATCTTGAACATGTCTTCATCTCGAGATGAAGACATGTTCAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-416s1c1
Sequence:CCGGCCTCAGCAAGAGATGACGATTCTCGAGAATCGTCATCTCTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-606s1c1
Sequence:CCGGCGACAGTACCTTCTGACGAAACTCGAGTTTCGTCAGAAGGTACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-1172s1c1
Sequence:CCGGCCACAGGCCAACAACAACAATCTCGAGATTGTTGTTGTTGGCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173484
KLF17 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173484.2-1294s1c1
Sequence:CCGGGCAGTCTTCAAGTTCTACATTCTCGAGAATGTAGAACTTGAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-159s1c1
Sequence:CCGGCCATCTTGAACATGTCTTCATCTCGAGATGAAGACATGTTCAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-416s1c1
Sequence:CCGGCCTCAGCAAGAGATGACGATTCTCGAGAATCGTCATCTCTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-606s1c1
Sequence:CCGGCGACAGTACCTTCTGACGAAACTCGAGTTTCGTCAGAAGGTACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-1172s1c1
Sequence:CCGGCCACAGGCCAACAACAACAATCTCGAGATTGTTGTTGTTGGCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173484
KLF17 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173484.2-1294s1c1
Sequence:CCGGGCAGTCTTCAAGTTCTACATTCTCGAGAATGTAGAACTTGAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-159s1c1
Sequence:CCGGCCATCTTGAACATGTCTTCATCTCGAGATGAAGACATGTTCAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-416s1c1
Sequence:CCGGCCTCAGCAAGAGATGACGATTCTCGAGAATCGTCATCTCTTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-606s1c1
Sequence:CCGGCGACAGTACCTTCTGACGAAACTCGAGTTTCGTCAGAAGGTACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173484.2-1172s1c1
Sequence:CCGGCCACAGGCCAACAACAACAATCTCGAGATTGTTGTTGTTGGCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029416
KLF17 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029416.1-2195s1c1
Sequence:CCGGGCCTGGAAAGTTCTGGAGTTACTCGAGTAACTCCAGAACTTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-849s1c1
Sequence:CCGGGCCTTATGTCTGCACATATAACTCGAGTTATATGTGCAGACATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-637s1c1
Sequence:CCGGCAGATGTTGCACTCCATAAATCTCGAGATTTATGGAGTGCAACATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-634s1c1
Sequence:CCGGGATCAGATGTTGCACTCCATACTCGAGTATGGAGTGCAACATCTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-340s1c1
Sequence:CCGGGCTCCTATACCTTTCCAGAATCTCGAGATTCTGGAAAGGTATAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-646s21c1
Sequence:CCGGCCATGCTGTGGCTCCGTTTATCTCGAGATAAACGGAGCCACAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-755s21c1
Sequence:CCGGTCACTTGTGACTGAGTCAAATCTCGAGATTTGACTCAGTCACAAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029416
KLF17 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029416.1-2195s1c1
Sequence:CCGGGCCTGGAAAGTTCTGGAGTTACTCGAGTAACTCCAGAACTTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-849s1c1
Sequence:CCGGGCCTTATGTCTGCACATATAACTCGAGTTATATGTGCAGACATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-637s1c1
Sequence:CCGGCAGATGTTGCACTCCATAAATCTCGAGATTTATGGAGTGCAACATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-634s1c1
Sequence:CCGGGATCAGATGTTGCACTCCATACTCGAGTATGGAGTGCAACATCTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-340s1c1
Sequence:CCGGGCTCCTATACCTTTCCAGAATCTCGAGATTCTGGAAAGGTATAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-646s21c1
Sequence:CCGGCCATGCTGTGGCTCCGTTTATCTCGAGATAAACGGAGCCACAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-755s21c1
Sequence:CCGGTCACTTGTGACTGAGTCAAATCTCGAGATTTGACTCAGTCACAAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029416
KLF17 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029416.1-2195s1c1
Sequence:CCGGGCCTGGAAAGTTCTGGAGTTACTCGAGTAACTCCAGAACTTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-849s1c1
Sequence:CCGGGCCTTATGTCTGCACATATAACTCGAGTTATATGTGCAGACATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-637s1c1
Sequence:CCGGCAGATGTTGCACTCCATAAATCTCGAGATTTATGGAGTGCAACATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-634s1c1
Sequence:CCGGGATCAGATGTTGCACTCCATACTCGAGTATGGAGTGCAACATCTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029416.1-340s1c1
Sequence:CCGGGCTCCTATACCTTTCCAGAATCTCGAGATTCTGGAAAGGTATAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-646s21c1
Sequence:CCGGCCATGCTGTGGCTCCGTTTATCTCGAGATAAACGGAGCCACAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029416.2-755s21c1
Sequence:CCGGTCACTTGTGACTGAGTCAAATCTCGAGATTTGACTCAGTCACAAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)