EMAIL THIS PAGE TO A FRIEND

KLF1

Kruppel-like factor 1 (erythroid)

54 Gene Product Result for
Synonyms: EKLF HBFQTL6 INLU
UniProtKB ID: Q13351, Q6PIJ5, Q92899
Gene ID:
Human(10661) Summary: This gene encodes a hematopoietic-specific transcription factor that induces high-level expression of adult beta-globin and other erythroid genes. The zinc-finger protein binds to the DNA sequence CCACACCCT found in the beta hemoglobin promoter. Heterozygous loss-of-function mutations in this gene result in the dominant In(Lu) blood phenotype. [provided by RefSeq, Oct 2009]
Mouse(16596) Kruppel-like factor 1 (erythroid)
Rat(304666) Kruppel-like factor 1 (erythroid)
chicken(424577) Kruppel-like factor 1 (erythroid)
dog(484924) Kruppel-like factor 1 (erythroid)
domestic cat(101093338) Kruppel-like factor 1 (erythroid)
cow(784295) Kruppel-like factor 1 (erythroid)
sheep(101122437) Kruppel-like factor 1 (erythroid)
domestic guinea pig(100728698) Kruppel-like factor 1 (erythroid)
naked mole-rat(101716985) Kruppel-like factor 1 (erythroid)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500142 Anti-KLF antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB1412530 ANTI-KLF1 antibody produced in mouse clone 4E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412531 ANTI-KLF1 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412532 ANTI-KLF1 antibody produced in mouse clone 2A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV31493 Anti-KLF1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV32810 Anti-KLF1 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA051850 Anti-KLF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB2104023 Anti-KLF1, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2500563 Anti-KLF1/EKLF antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA pricing
WH0010661M1 Monoclonal Anti-KLF1 antibody produced in mouse clone 5D7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404855 Monoclonal Anti-KLF1 antibody produced in mouse clone 5G12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006563 Rosetta Predictions human pricing
NM_001107164 Rosetta Predictions rat pricing
NM_010635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034449 predicted 674
2 SASI_Hs01_00034450 predicted 855
3 SASI_Hs01_00034451 predicted 385
4 SASI_Hs01_00034452 predicted 846
5 SASI_Hs01_00034453 predicted 804
6 SASI_Hs01_00034454 predicted 864
7 SASI_Hs01_00034455 predicted 670
8 SASI_Hs01_00034456 predicted 444
9 SASI_Hs01_00034457 predicted 873
10 SASI_Hs01_00034458 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226135 predicted 1145
2 SASI_Rn02_00226136 predicted 1270
3 SASI_Rn02_00226137 predicted 581
4 SASI_Rn02_00226138 predicted 236
5 SASI_Rn02_00226139 predicted 1137
6 SASI_Rn02_00226140 predicted 1054
7 SASI_Rn02_00226141 predicted 692
8 SASI_Rn02_00226142 predicted 1231
9 SASI_Rn02_00226143 predicted 1201
10 SASI_Rn02_00226144 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158563 predicted 418
2 SASI_Mm01_00158564 predicted 1268
3 SASI_Mm01_00158566 predicted 1140
4 SASI_Mm01_00158567 predicted 1047
5 SASI_Mm01_00158568 predicted 408
6 SASI_Mm01_00158569 predicted 1032
7 SASI_Mm02_00318984 predicted 873
8 SASI_Mm01_00158570 predicted 892
9 SASI_Mm01_00158571 predicted 1036
10 SASI_Mm01_00158572 predicted 912
11 SASI_Mm01_00158565 predicted 1296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006563
KLF1 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 1 (erythroid)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-441s21c1
Sequence:CCGGTTTGGGTTCGGAGGATCACTCCTCGAGGAGTGATCCTCCGAACCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-818s21c1
Sequence:CCGGCAGAGGATCCAGGTGTGATAGCTCGAGCTATCACACCTGGATCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006563.3-1295s21c1
Sequence:GTACCGGAGATCCACCCAAATATCAAACCTCGAGGTTTGATATTTGGGTGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-1130s21c1
Sequence:CCGGTGCACATGAAGCGCCACCTTTCTCGAGAAAGGTGGCGCTTCATGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-760s21c1
Sequence:CCGGCCCTCCTTCCTGAGTTGTTTGCTCGAGCAAACAACTCAGGAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006563.2-1290s1c1
Sequence:CCGGCCCAAAGATCCACCCAAATATCTCGAGATATTTGGGTGGATCTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-391s1c1
Sequence:CCGGCCCGAGACTCTGGGCGCATATCTCGAGATATGCGCCCAGAGTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-817s1c1
Sequence:CCGGGCAGAGGATCCAGGTGTGATACTCGAGTATCACACCTGGATCCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-216s1c1
Sequence:CCGGCCACGTGAAGTCTGAGGACCACTCGAGTGGTCCTCAGACTTCACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-690s1c1
Sequence:CCGGGCCTCAGTACCAAGGGCACTTCTCGAGAAGTGCCCTTGGTACTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006563
KLF1 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 1 (erythroid)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-441s21c1
Sequence:CCGGTTTGGGTTCGGAGGATCACTCCTCGAGGAGTGATCCTCCGAACCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-818s21c1
Sequence:CCGGCAGAGGATCCAGGTGTGATAGCTCGAGCTATCACACCTGGATCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006563.3-1295s21c1
Sequence:GTACCGGAGATCCACCCAAATATCAAACCTCGAGGTTTGATATTTGGGTGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-1130s21c1
Sequence:CCGGTGCACATGAAGCGCCACCTTTCTCGAGAAAGGTGGCGCTTCATGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-760s21c1
Sequence:CCGGCCCTCCTTCCTGAGTTGTTTGCTCGAGCAAACAACTCAGGAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006563.2-1290s1c1
Sequence:CCGGCCCAAAGATCCACCCAAATATCTCGAGATATTTGGGTGGATCTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-391s1c1
Sequence:CCGGCCCGAGACTCTGGGCGCATATCTCGAGATATGCGCCCAGAGTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-817s1c1
Sequence:CCGGGCAGAGGATCCAGGTGTGATACTCGAGTATCACACCTGGATCCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-216s1c1
Sequence:CCGGCCACGTGAAGTCTGAGGACCACTCGAGTGGTCCTCAGACTTCACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-690s1c1
Sequence:CCGGGCCTCAGTACCAAGGGCACTTCTCGAGAAGTGCCCTTGGTACTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006563
KLF1 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 1 (erythroid)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-441s21c1
Sequence:CCGGTTTGGGTTCGGAGGATCACTCCTCGAGGAGTGATCCTCCGAACCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-818s21c1
Sequence:CCGGCAGAGGATCCAGGTGTGATAGCTCGAGCTATCACACCTGGATCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006563.3-1295s21c1
Sequence:GTACCGGAGATCCACCCAAATATCAAACCTCGAGGTTTGATATTTGGGTGGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-1130s21c1
Sequence:CCGGTGCACATGAAGCGCCACCTTTCTCGAGAAAGGTGGCGCTTCATGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006563.3-760s21c1
Sequence:CCGGCCCTCCTTCCTGAGTTGTTTGCTCGAGCAAACAACTCAGGAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006563.2-1290s1c1
Sequence:CCGGCCCAAAGATCCACCCAAATATCTCGAGATATTTGGGTGGATCTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-391s1c1
Sequence:CCGGCCCGAGACTCTGGGCGCATATCTCGAGATATGCGCCCAGAGTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-817s1c1
Sequence:CCGGGCAGAGGATCCAGGTGTGATACTCGAGTATCACACCTGGATCCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-216s1c1
Sequence:CCGGCCACGTGAAGTCTGAGGACCACTCGAGTGGTCCTCAGACTTCACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006563.2-690s1c1
Sequence:CCGGGCCTCAGTACCAAGGGCACTTCTCGAGAAGTGCCCTTGGTACTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010635
KLF1 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 1 (erythroid)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-944s1c1
Sequence:CCGGCTGCGGGAAGAGCTACTCCAACTCGAGTTGGAGTAGCTCTTCCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-890s1c1
Sequence:CCGGCCGGCGAACTTTGGCACCTAACTCGAGTTAGGTGCCAAAGTTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-113s1c1
Sequence:CCGGTGAGACTGTCTTACCCTCCATCTCGAGATGGAGGGTAAGACAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-1145s1c1
Sequence:CCGGCCACTTAGCTCTGCACATGAACTCGAGTTCATGTGCAGAGCTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-249s1c1
Sequence:CCGGTCCCTTCACGTGAGTCTGAAACTCGAGTTTCAGACTCACGTGAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010635
KLF1 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 1 (erythroid)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-944s1c1
Sequence:CCGGCTGCGGGAAGAGCTACTCCAACTCGAGTTGGAGTAGCTCTTCCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-890s1c1
Sequence:CCGGCCGGCGAACTTTGGCACCTAACTCGAGTTAGGTGCCAAAGTTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-113s1c1
Sequence:CCGGTGAGACTGTCTTACCCTCCATCTCGAGATGGAGGGTAAGACAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-1145s1c1
Sequence:CCGGCCACTTAGCTCTGCACATGAACTCGAGTTCATGTGCAGAGCTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-249s1c1
Sequence:CCGGTCCCTTCACGTGAGTCTGAAACTCGAGTTTCAGACTCACGTGAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010635
KLF1 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 1 (erythroid)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-944s1c1
Sequence:CCGGCTGCGGGAAGAGCTACTCCAACTCGAGTTGGAGTAGCTCTTCCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-890s1c1
Sequence:CCGGCCGGCGAACTTTGGCACCTAACTCGAGTTAGGTGCCAAAGTTCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-113s1c1
Sequence:CCGGTGAGACTGTCTTACCCTCCATCTCGAGATGGAGGGTAAGACAGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-1145s1c1
Sequence:CCGGCCACTTAGCTCTGCACATGAACTCGAGTTCATGTGCAGAGCTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010635.1-249s1c1
Sequence:CCGGTCCCTTCACGTGAGTCTGAAACTCGAGTTTCAGACTCACGTGAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)