EMAIL THIS PAGE TO A FRIEND

KLF2

Kruppel-like factor 2 (lung)

89 Gene Product Result for
Synonyms: LKLF
UniProtKB ID: Q9Y5W3, Q6IPC4, Q9UJS5, Q9UKR6
Gene ID:
Human(10365) Summary: Kruppel-like factors (KLFs) are a family of broadly expressed zinc finger transcription factors. KLF2 regulates T-cell trafficking by promoting expression of the lipid-binding receptor S1P1 (S1PR1; MIM 601974) and the selectin CD62L (SELL; MIM 153240) (summary by Weinreich et al., 2009 [PubMed 19592277]
Mouse(16598) Kruppel-like factor 2 (lung)
Rat(306330) Kruppel-like factor 2 (lung)
chicken(420148) Kruppel-like factor 2 (lung)
cow(520939) Kruppel-like factor 2 (lung)
domestic guinea pig(100729428) Kruppel-like factor 2 (lung)
naked mole-rat(101699840) Kruppel-like factor 2 (lung)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108513 Anti-KLF2 IgG fraction of antiserum mouse, horse, pig, human
western blot pricing
SAB2108684 Anti-KLF2 affinity isolated antibody human, zebrafish, pig, mouse, rat, guinea pig
ChIP, immunohistochemistry, western blot pricing
SAB1101046 Anti-KLF2 (21-35) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2108355 Anti-Klf2 antibody produced in rabbit affinity isolated antibody mouse
western blot pricing
SAB2108320 Anti-KLF2 antibody produced in rabbit affinity isolated antibody human, canine, rabbit, rat, pig, horse, rabbit, guinea pig, mouse
western blot pricing
AV37859 Anti-KLF2 antibody produced in rabbit IgG fraction of antiserum human, mouse, rat, pig
western blot pricing
SAB2101275 Anti-KLF2 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, pig, rat, human, zebrafish
western blot pricing
SAB2104475 Anti-KLF2 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, human, chicken, pig, rat, horse, canine, mouse, rabbit
western blot pricing
HPA055964 Anti-KLF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105268 Anti-KLF2, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse
western blot pricing
SAB1403063 Monoclonal Anti-KLF2 antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016270 Rosetta Predictions human pricing
NM_001007684 Rosetta Predictions rat pricing
XM_579181 Rosetta Predictions rat pricing
NM_008452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227239 predicted 1352
2 SASI_Hs02_00349172 predicted 1521
3 SASI_Hs02_00349173 predicted 1475
4 SASI_Hs02_00349174 predicted 1530
5 SASI_Hs02_00349175 predicted 1445
6 SASI_Hs01_00227243 predicted 1029
7 SASI_Hs01_00227244 predicted 1327
8 SASI_Hs02_00349176 predicted 1464
9 SASI_Hs01_00227246 predicted 931
10 SASI_Hs02_00349177 predicted 1548
11 SASI_Hs01_00227240 predicted 1116
12 SASI_Hs01_00227241 predicted 1242
13 SASI_Hs01_00227242 predicted 1355
14 SASI_Hs01_00227245 predicted 1392
15 SASI_Hs01_00227247 predicted 667
16 SASI_Hs01_00227248 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089591 predicted 836
2 SASI_Rn01_00089592 predicted 827
3 SASI_Rn01_00089593 predicted 256
4 SASI_Rn01_00089594 predicted 251
5 SASI_Rn01_00089595 predicted 790
6 SASI_Rn01_00089596 predicted 809
7 SASI_Rn01_00089597 predicted 278
8 SASI_Rn01_00089598 predicted 795
9 SASI_Rn01_00089599 predicted 783
10 SASI_Rn01_00089600 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126881 predicted 842
2 SASI_Rn01_00126882 predicted 840
3 SASI_Rn01_00126883 predicted 265
4 SASI_Rn01_00126884 predicted 262
5 SASI_Rn01_00126885 predicted 796
6 SASI_Rn01_00126886 predicted 813
7 SASI_Rn01_00126887 predicted 289
8 SASI_Rn01_00126888 predicted 800
9 SASI_Rn01_00126889 predicted 788
10 SASI_Rn01_00126890 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128139 predicted 1182
2 SASI_Mm02_00313949 predicted 834
3 SASI_Mm01_00128140 predicted 1000
4 SASI_Mm01_00128141 predicted 1138
5 SASI_Mm01_00128142 predicted 954
6 SASI_Mm01_00128143 predicted 895
7 SASI_Mm01_00128144 predicted 1074
8 SASI_Mm01_00128145 predicted 874
9 SASI_Mm01_00128146 predicted 860
10 SASI_Mm01_00128147 predicted 906
11 SASI_Mm01_00128148 predicted 1284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016270
KLF2 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 2 (lung)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1397s21c1
Sequence:CCGGCAATAATTTAAGTGGCATCTTCTCGAGAAGATGCCACTTAAATTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1359s21c1
Sequence:CCGGACGATCCTCCTTGACGAGTTTCTCGAGAAACTCGTCAAGGAGGATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016270.2-1128s21c1
Sequence:CCGGGCTGCACATGAAACGGCACATCTCGAGATGTGCCGTTTCATGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1452s21c1
Sequence:CCGGTTGTGATGCCTTGTGAGAAATCTCGAGATTTCTCACAAGGCATCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016270.1-1218s1c1
Sequence:CCGGCCAAACTGTGACTGGTATTTACTCGAGTAAATACCAGTCACAGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-668s1c1
Sequence:CCGGCGCCTTTCGGTGGCCCTGGTTCTCGAGAACCAGGGCCACCGAAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-189s1c1
Sequence:CCGGCGGCACCGACGACGACCTCAACTCGAGTTGAGGTCGTCGTCGGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-1069s1c1
Sequence:CCGGCACCGGCCATTCCAGTGCCATCTCGAGATGGCACTGGAATGGCCGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-940s1c1
Sequence:CCGGAGTTCGCATCTGAAGGCGCATCTCGAGATGCGCCTTCAGATGCGAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016270
KLF2 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 2 (lung)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1397s21c1
Sequence:CCGGCAATAATTTAAGTGGCATCTTCTCGAGAAGATGCCACTTAAATTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1359s21c1
Sequence:CCGGACGATCCTCCTTGACGAGTTTCTCGAGAAACTCGTCAAGGAGGATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016270.2-1128s21c1
Sequence:CCGGGCTGCACATGAAACGGCACATCTCGAGATGTGCCGTTTCATGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1452s21c1
Sequence:CCGGTTGTGATGCCTTGTGAGAAATCTCGAGATTTCTCACAAGGCATCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016270.1-1218s1c1
Sequence:CCGGCCAAACTGTGACTGGTATTTACTCGAGTAAATACCAGTCACAGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-668s1c1
Sequence:CCGGCGCCTTTCGGTGGCCCTGGTTCTCGAGAACCAGGGCCACCGAAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-189s1c1
Sequence:CCGGCGGCACCGACGACGACCTCAACTCGAGTTGAGGTCGTCGTCGGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-1069s1c1
Sequence:CCGGCACCGGCCATTCCAGTGCCATCTCGAGATGGCACTGGAATGGCCGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-940s1c1
Sequence:CCGGAGTTCGCATCTGAAGGCGCATCTCGAGATGCGCCTTCAGATGCGAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016270
KLF2 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 2 (lung)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1397s21c1
Sequence:CCGGCAATAATTTAAGTGGCATCTTCTCGAGAAGATGCCACTTAAATTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1359s21c1
Sequence:CCGGACGATCCTCCTTGACGAGTTTCTCGAGAAACTCGTCAAGGAGGATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016270.2-1128s21c1
Sequence:CCGGGCTGCACATGAAACGGCACATCTCGAGATGTGCCGTTTCATGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016270.2-1452s21c1
Sequence:CCGGTTGTGATGCCTTGTGAGAAATCTCGAGATTTCTCACAAGGCATCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016270.1-1218s1c1
Sequence:CCGGCCAAACTGTGACTGGTATTTACTCGAGTAAATACCAGTCACAGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-668s1c1
Sequence:CCGGCGCCTTTCGGTGGCCCTGGTTCTCGAGAACCAGGGCCACCGAAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-189s1c1
Sequence:CCGGCGGCACCGACGACGACCTCAACTCGAGTTGAGGTCGTCGTCGGTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-1069s1c1
Sequence:CCGGCACCGGCCATTCCAGTGCCATCTCGAGATGGCACTGGAATGGCCGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016270.1-940s1c1
Sequence:CCGGAGTTCGCATCTGAAGGCGCATCTCGAGATGCGCCTTCAGATGCGAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008452
VALIDATED
KLF2 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 2 (lung)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1415s21c1
Sequence:CCGGGACCGATTGTATTTCTATAAGCTCGAGCTTATAGAAATACAATCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-133s21c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-1057s21c1
Sequence:CCGGCTTGCACATGAAGCGACACATCTCGAGATGTGTCGCTTCATGTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1002s21c1
Sequence:CCGGGACCCTTTCAGTGCCACTTGTCTCGAGACAAGTGGCACTGAAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-862s21c1
Sequence:CCGGCACCAAGAGCTCGCACCTAAACTCGAGTTTAGGTGCGAGCTCTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008452.1-1177s1c1
Sequence:CCGGGCAAACAGACTGCTATTTATTCTCGAGAATAAATAGCAGTCTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-849s1c1
Sequence:CCGGCGCCACACATACTTGCAGCTACTCGAGTAGCTGCAAGTATGTGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-162s1c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-943s1c1
Sequence:CCGGCCTTATCATTGCAACTGGGAACTCGAGTTCCCAGTTGCAATGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-156s1c1
Sequence:CCGGTGAGGACCTAAACAACGTGTTCTCGAGAACACGTTGTTTAGGTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008452
VALIDATED
KLF2 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 2 (lung)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1415s21c1
Sequence:CCGGGACCGATTGTATTTCTATAAGCTCGAGCTTATAGAAATACAATCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-133s21c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-1057s21c1
Sequence:CCGGCTTGCACATGAAGCGACACATCTCGAGATGTGTCGCTTCATGTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1002s21c1
Sequence:CCGGGACCCTTTCAGTGCCACTTGTCTCGAGACAAGTGGCACTGAAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-862s21c1
Sequence:CCGGCACCAAGAGCTCGCACCTAAACTCGAGTTTAGGTGCGAGCTCTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008452.1-1177s1c1
Sequence:CCGGGCAAACAGACTGCTATTTATTCTCGAGAATAAATAGCAGTCTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-849s1c1
Sequence:CCGGCGCCACACATACTTGCAGCTACTCGAGTAGCTGCAAGTATGTGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-162s1c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-943s1c1
Sequence:CCGGCCTTATCATTGCAACTGGGAACTCGAGTTCCCAGTTGCAATGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-156s1c1
Sequence:CCGGTGAGGACCTAAACAACGTGTTCTCGAGAACACGTTGTTTAGGTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008452
VALIDATED
KLF2 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 2 (lung)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1415s21c1
Sequence:CCGGGACCGATTGTATTTCTATAAGCTCGAGCTTATAGAAATACAATCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-133s21c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-1057s21c1
Sequence:CCGGCTTGCACATGAAGCGACACATCTCGAGATGTGTCGCTTCATGTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008452.2-1002s21c1
Sequence:CCGGGACCCTTTCAGTGCCACTTGTCTCGAGACAAGTGGCACTGAAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008452.2-862s21c1
Sequence:CCGGCACCAAGAGCTCGCACCTAAACTCGAGTTTAGGTGCGAGCTCTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008452.1-1177s1c1
Sequence:CCGGGCAAACAGACTGCTATTTATTCTCGAGAATAAATAGCAGTCTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-849s1c1
Sequence:CCGGCGCCACACATACTTGCAGCTACTCGAGTAGCTGCAAGTATGTGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-162s1c1
Sequence:CCGGCCTAAACAACGTGTTGGACTTCTCGAGAAGTCCAACACGTTGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008452.1-943s1c1
Sequence:CCGGCCTTATCATTGCAACTGGGAACTCGAGTTCCCAGTTGCAATGATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008452.1-156s1c1
Sequence:CCGGTGAGGACCTAAACAACGTGTTCTCGAGAACACGTTGTTTAGGTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)