EMAIL THIS PAGE TO A FRIEND

KLF3

Kruppel-like factor 3 (basic)

79 Gene Product Result for
Synonyms: BKLF
UniProtKB ID: P57682, Q6PIR1, Q86TN0, Q9P2X6
Gene ID:
Mouse(16599) Kruppel-like factor 3 (basic)
Rat(114845) Kruppel-like factor 3 (basic)
Zebrafish(117603) Kruppel-like factor 3 (basic)
chicken(429811) Kruppel-like factor 3 (basic)
dog(488836) Kruppel-like factor 3 (basic)
domestic cat(101085798) Kruppel-like factor 3 (basic)
cow(530358) Kruppel-like factor 3 (basic)
sheep(101111966) Kruppel-like factor 3 (basic)
domestic guinea pig(100713661) Kruppel-like factor 3 (basic)
naked mole-rat(101716244) Kruppel-like factor 3 (basic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120501 MISSION® esiRNA esiRNA human KLF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016531 Rosetta Predictions human pricing
NM_001105742 Rosetta Predictions rat pricing
NM_008453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015318 predicted 1114
2 SASI_Hs01_00015319 predicted 437
3 SASI_Hs01_00015320 predicted 1105
4 SASI_Hs01_00015321 predicted 829
5 SASI_Hs01_00015322 predicted 1004
6 SASI_Hs02_00349636 predicted 1233
7 SASI_Hs01_00015324 predicted 1249
8 SASI_Hs01_00015323 predicted 1114
9 SASI_Hs01_00015326 predicted 1099
10 SASI_Hs01_00015327 predicted 932
11 SASI_Hs01_00015325 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212086 predicted 308
2 SASI_Rn02_00212087 predicted 1607
3 SASI_Rn02_00212088 predicted 1576
4 SASI_Rn02_00212089 predicted 329
5 SASI_Rn02_00212090 predicted 1011
6 SASI_Rn02_00212091 predicted 1757
7 SASI_Rn02_00212092 predicted 1661
8 SASI_Rn02_00212093 predicted 1022
9 SASI_Rn02_00212094 predicted 781
10 SASI_Rn02_00212095 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167530 predicted 1653
2 SASI_Mm01_00167531 predicted 847
3 SASI_Mm01_00167532 predicted 1084
4 SASI_Mm02_00313950 predicted 1736
5 SASI_Mm01_00167534 predicted 1102
6 SASI_Mm01_00167535 predicted 405
7 SASI_Mm02_00313951 predicted 660
8 SASI_Mm01_00167537 predicted 375
9 SASI_Mm01_00167533 predicted 1638
10 SASI_Mm01_00167539 predicted 856
11 SASI_Mm01_00167536 predicted 1716
12 SASI_Mm01_00167538 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016531
VALIDATED
KLF3 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 3 (basic)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-386s21c1
Sequence:CCGGAGTGTCATACCCATCTAATTACTCGAGTAATTAGATGGGTATGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016531.5-4280s21c1
Sequence:CCGGTGTTAGCAGCATAGCTATATTCTCGAGAATATAGCTATGCTGCTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-626s21c1
Sequence:CCGGTTCTTCCAGCCCACCGATAAACTCGAGTTTATCGGTGGGCTGGAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-1103s21c1
Sequence:GTACCGGGAGGATACACAGATGTGATTACTCGAGTAATCACATCTGTGTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016531.3-1131s1c1
Sequence:CCGGCCCACTTGAAAGCACACAGAACTCGAGTTCTGTGTGCTTTCAAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1076s1c1
Sequence:CCGGCGGAGGATACACAGATGTGATCTCGAGATCACATCTGTGTATCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1219s1c1
Sequence:CCGGTGGTGAACTAACAAGACATTTCTCGAGAAATGTCTTGTTAGTTCACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-985s1c1
Sequence:CCGGGCAAGCATTGTTGCAAGAGAACTCGAGTTCTCTTGCAACAATGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-360s1c1
Sequence:CCGGCAGTGTCATACCCATCTAATTCTCGAGAATTAGATGGGTATGACACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-876s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016531
VALIDATED
KLF3 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 3 (basic)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-386s21c1
Sequence:CCGGAGTGTCATACCCATCTAATTACTCGAGTAATTAGATGGGTATGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016531.5-4280s21c1
Sequence:CCGGTGTTAGCAGCATAGCTATATTCTCGAGAATATAGCTATGCTGCTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-626s21c1
Sequence:CCGGTTCTTCCAGCCCACCGATAAACTCGAGTTTATCGGTGGGCTGGAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-1103s21c1
Sequence:GTACCGGGAGGATACACAGATGTGATTACTCGAGTAATCACATCTGTGTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016531.3-1131s1c1
Sequence:CCGGCCCACTTGAAAGCACACAGAACTCGAGTTCTGTGTGCTTTCAAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1076s1c1
Sequence:CCGGCGGAGGATACACAGATGTGATCTCGAGATCACATCTGTGTATCCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1219s1c1
Sequence:CCGGTGGTGAACTAACAAGACATTTCTCGAGAAATGTCTTGTTAGTTCACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-985s1c1
Sequence:CCGGGCAAGCATTGTTGCAAGAGAACTCGAGTTCTCTTGCAACAATGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-360s1c1
Sequence:CCGGCAGTGTCATACCCATCTAATTCTCGAGAATTAGATGGGTATGACACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-876s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016531
VALIDATED
KLF3 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 3 (basic)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-386s21c1
Sequence:CCGGAGTGTCATACCCATCTAATTACTCGAGTAATTAGATGGGTATGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016531.5-4280s21c1
Sequence:CCGGTGTTAGCAGCATAGCTATATTCTCGAGAATATAGCTATGCTGCTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-626s21c1
Sequence:CCGGTTCTTCCAGCCCACCGATAAACTCGAGTTTATCGGTGGGCTGGAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-1103s21c1
Sequence:GTACCGGGAGGATACACAGATGTGATTACTCGAGTAATCACATCTGTGTATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_016531.3-1131s1c1
Sequence:CCGGCCCACTTGAAAGCACACAGAACTCGAGTTCTGTGTGCTTTCAAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1076s1c1
Sequence:CCGGCGGAGGATACACAGATGTGATCTCGAGATCACATCTGTGTATCCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-1219s1c1
Sequence:CCGGTGGTGAACTAACAAGACATTTCTCGAGAAATGTCTTGTTAGTTCACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-985s1c1
Sequence:CCGGGCAAGCATTGTTGCAAGAGAACTCGAGTTCTCTTGCAACAATGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016531.3-360s1c1
Sequence:CCGGCAGTGTCATACCCATCTAATTCTCGAGAATTAGATGGGTATGACACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016531.5-876s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008453
VALIDATED
KLF3 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 3 (basic)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008453.5-1435s21c1
Sequence:CCGGTGCCCGTTATCTAACTCATTTCTCGAGAAATGAGTTAGATAACGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008453.5-1217s21c1
Sequence:GTACCGGTGATGAACTGACGAGACATTTCTCGAGAAATGTCTCGTCAGTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-1104s21c1
Sequence:GTACCGGTGCAATAAGGTCTACACTAAGCTCGAGCTTAGTGTAGACCTTATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-362s21c1
Sequence:CCGGGGTGTCCTTCCCGTCGAATTACTCGAGTAATTCGACGGGAAGGACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-849s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1090s1c1
Sequence:CCGGCGACTATGATGGGTGCAATAACTCGAGTTATTGCACCCATCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008453.2-846s1c1
Sequence:CCGGCAGTACCTGTAATTGAATCATCTCGAGATGATTCAATTACAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-372s1c1
Sequence:CCGGCGTCGAATTACATAGAATCGACTCGAGTCGATTCTATGTAATTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1089s1c1
Sequence:CCGGGCGACTATGATGGGTGCAATACTCGAGTATTGCACCCATCATAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008453.2-1615s1c1
Sequence:CCGGCCCTCCTTACAGATACATTTACTCGAGTAAATGTATCTGTAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008453
VALIDATED
KLF3 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 3 (basic)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008453.5-1435s21c1
Sequence:CCGGTGCCCGTTATCTAACTCATTTCTCGAGAAATGAGTTAGATAACGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008453.5-1217s21c1
Sequence:GTACCGGTGATGAACTGACGAGACATTTCTCGAGAAATGTCTCGTCAGTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-1104s21c1
Sequence:GTACCGGTGCAATAAGGTCTACACTAAGCTCGAGCTTAGTGTAGACCTTATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-362s21c1
Sequence:CCGGGGTGTCCTTCCCGTCGAATTACTCGAGTAATTCGACGGGAAGGACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-849s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1090s1c1
Sequence:CCGGCGACTATGATGGGTGCAATAACTCGAGTTATTGCACCCATCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008453.2-846s1c1
Sequence:CCGGCAGTACCTGTAATTGAATCATCTCGAGATGATTCAATTACAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-372s1c1
Sequence:CCGGCGTCGAATTACATAGAATCGACTCGAGTCGATTCTATGTAATTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1089s1c1
Sequence:CCGGGCGACTATGATGGGTGCAATACTCGAGTATTGCACCCATCATAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008453.2-1615s1c1
Sequence:CCGGCCCTCCTTACAGATACATTTACTCGAGTAAATGTATCTGTAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008453
VALIDATED
KLF3 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 3 (basic)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008453.5-1435s21c1
Sequence:CCGGTGCCCGTTATCTAACTCATTTCTCGAGAAATGAGTTAGATAACGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008453.5-1217s21c1
Sequence:GTACCGGTGATGAACTGACGAGACATTTCTCGAGAAATGTCTCGTCAGTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-1104s21c1
Sequence:GTACCGGTGCAATAAGGTCTACACTAAGCTCGAGCTTAGTGTAGACCTTATTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-362s21c1
Sequence:CCGGGGTGTCCTTCCCGTCGAATTACTCGAGTAATTCGACGGGAAGGACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008453.5-849s21c1
Sequence:CCGGGTACCTGTAATTGAATCATATCTCGAGATATGATTCAATTACAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1090s1c1
Sequence:CCGGCGACTATGATGGGTGCAATAACTCGAGTTATTGCACCCATCATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008453.2-846s1c1
Sequence:CCGGCAGTACCTGTAATTGAATCATCTCGAGATGATTCAATTACAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-372s1c1
Sequence:CCGGCGTCGAATTACATAGAATCGACTCGAGTCGATTCTATGTAATTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008453.2-1089s1c1
Sequence:CCGGGCGACTATGATGGGTGCAATACTCGAGTATTGCACCCATCATAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008453.2-1615s1c1
Sequence:CCGGCCCTCCTTACAGATACATTTACTCGAGTAAATGTATCTGTAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)