EMAIL THIS PAGE TO A FRIEND

KLF4

Kruppel-like factor 4 (gut)

124 Gene Product Result for
Synonyms: EZF GKLF
Gene ID:
Mouse(16600) Kruppel-like factor 4 (gut)
Rat(114505) Kruppel-like factor 4 (gut)
chicken(770254) Kruppel-like factor 4 (gut)
Horse(100054047) Kruppel-like factor 4 (gut)
cow(520842) Kruppel-like factor 4 (gut)
domestic cat(100379626) Kruppel-like factor 4 (gut)
domestic guinea pig(100735339) Kruppel-like factor 4 (gut)
sheep(100302636) Kruppel-like factor 4 (gut)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107958 Anti-KLF4 antibody produced in rabbit affinity isolated antibody bovine, rabbit, horse, guinea pig, mouse, dog, human, rat
immunohistochemistry, western blot pricing
AV38430 Anti-KLF4 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, chicken, human, rabbit, canine, rat
western blot pricing
AV35721 Anti-KLF4 antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA002926 Anti-KLF4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1300678 Anti-KLF4 antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, western blot pricing
SAB2105308 Anti-KLF4 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB2701975 Anti-KLF4 antibody produced in rabbit mouse, human, rat
flow cytometry, immunoprecipitation (IP), western blot pricing
SAB2106435 Anti-KLF4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2500567 Anti-KLF4/GKLF antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB5300069 Monoclonal Anti-KLF4 antibody produced in mouse clone 1E6, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1543 Human KLF4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004235 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151801 MISSION® esiRNA esiRNA human KLF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004235 Rosetta Predictions human pricing
NM_053713 Rosetta Predictions rat pricing
NM_010637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123149 predicted 2021
2 SASI_Hs02_00337161 predicted 1709
3 SASI_Hs01_00123150 predicted 2025
4 SASI_Hs01_00123151 predicted 2036
5 SASI_Hs01_00123152 predicted 1338
6 SASI_Hs01_00123153 predicted 2037
7 SASI_Hs01_00123154 predicted 849
8 SASI_Hs01_00123156 predicted 1493
9 SASI_Hs01_00123157 predicted 2075
10 SASI_Hs01_00123158 predicted 411
11 SASI_Hs01_00123155 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109520 predicted 841
2 SASI_Rn01_00109521 predicted 729
3 SASI_Rn01_00109522 predicted 1279
4 SASI_Rn01_00109523 predicted 1179
5 SASI_Rn01_00109524 predicted 675
6 SASI_Rn01_00109525 predicted 1272
7 SASI_Rn01_00109526 predicted 392
8 SASI_Rn01_00109527 predicted 1974
9 SASI_Rn01_00109528 predicted 286
10 SASI_Rn01_00109529 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104981 predicted 1211
2 SASI_Mm02_00318987 predicted 1257
3 SASI_Mm01_00104982 predicted 1713
4 SASI_Mm01_00104983 predicted 1804
5 SASI_Mm01_00104984 predicted 907
6 SASI_Mm01_00104985 predicted 732
7 SASI_Mm01_00104986 predicted 864
8 SASI_Mm01_00104987 predicted 720
9 SASI_Mm01_00104988 predicted 921
10 SASI_Mm01_00104989 predicted 1219
11 SASI_Mm01_00104990 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010637
VALIDATED
KLF4 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 4 (gut)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-1826s1c1
Sequence:CCGGACCTATACCAAGAGTTCTCATCTCGAGATGAGAACTCTTGGTATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010637.1-740s1c1
Sequence:CCGGCTCTCTCACATGAAGCGACTTCTCGAGAAGTCGCTTCATGTGAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010637.3-2591s21c1
Sequence:CCGGCATGTTCTAACAGCCTAAATGCTCGAGCATTTAGGCTGTTAGAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-730s1c1
Sequence:CCGGGCGTGAGGAACTCTCTCACATCTCGAGATGTGAGAGAGTTCCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-899s1c1
Sequence:CCGGCTGGACCTAGACTTTATCCTTCTCGAGAAGGATAAAGTCTAGGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010637.1-2726s1c1
Sequence:CCGGCCAGGTAAATAAGCCTGGTTTCTCGAGAAACCAGGCTTATTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1797s21c1
Sequence:CCGGCCACCCACACTTGTGACTATGCTCGAGCATAGTCACAAGTGTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1332s21c1
Sequence:CCGGCGGTCATCAGTGTTAGCAAAGCTCGAGCTTTGCTAACACTGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1215s21c1
Sequence:CCGGAGTTGGACCCAGTATACATTCCTCGAGGAATGTATACTGGGTCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1149s21c1
Sequence:CCGGTCAACCTGGCGGACATCAATGCTCGAGCATTGATGTCCGCCAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010637
VALIDATED
KLF4 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 4 (gut)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-1826s1c1
Sequence:CCGGACCTATACCAAGAGTTCTCATCTCGAGATGAGAACTCTTGGTATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010637.1-740s1c1
Sequence:CCGGCTCTCTCACATGAAGCGACTTCTCGAGAAGTCGCTTCATGTGAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010637.3-2591s21c1
Sequence:CCGGCATGTTCTAACAGCCTAAATGCTCGAGCATTTAGGCTGTTAGAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-730s1c1
Sequence:CCGGGCGTGAGGAACTCTCTCACATCTCGAGATGTGAGAGAGTTCCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-899s1c1
Sequence:CCGGCTGGACCTAGACTTTATCCTTCTCGAGAAGGATAAAGTCTAGGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010637.1-2726s1c1
Sequence:CCGGCCAGGTAAATAAGCCTGGTTTCTCGAGAAACCAGGCTTATTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1797s21c1
Sequence:CCGGCCACCCACACTTGTGACTATGCTCGAGCATAGTCACAAGTGTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1332s21c1
Sequence:CCGGCGGTCATCAGTGTTAGCAAAGCTCGAGCTTTGCTAACACTGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1215s21c1
Sequence:CCGGAGTTGGACCCAGTATACATTCCTCGAGGAATGTATACTGGGTCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1149s21c1
Sequence:CCGGTCAACCTGGCGGACATCAATGCTCGAGCATTGATGTCCGCCAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010637
VALIDATED
KLF4 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 4 (gut)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-1826s1c1
Sequence:CCGGACCTATACCAAGAGTTCTCATCTCGAGATGAGAACTCTTGGTATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010637.1-740s1c1
Sequence:CCGGCTCTCTCACATGAAGCGACTTCTCGAGAAGTCGCTTCATGTGAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010637.3-2591s21c1
Sequence:CCGGCATGTTCTAACAGCCTAAATGCTCGAGCATTTAGGCTGTTAGAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-730s1c1
Sequence:CCGGGCGTGAGGAACTCTCTCACATCTCGAGATGTGAGAGAGTTCCTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010637.1-899s1c1
Sequence:CCGGCTGGACCTAGACTTTATCCTTCTCGAGAAGGATAAAGTCTAGGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095369    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010637.1-2726s1c1
Sequence:CCGGCCAGGTAAATAAGCCTGGTTTCTCGAGAAACCAGGCTTATTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1797s21c1
Sequence:CCGGCCACCCACACTTGTGACTATGCTCGAGCATAGTCACAAGTGTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1332s21c1
Sequence:CCGGCGGTCATCAGTGTTAGCAAAGCTCGAGCTTTGCTAACACTGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1215s21c1
Sequence:CCGGAGTTGGACCCAGTATACATTCCTCGAGGAATGTATACTGGGTCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010637.3-1149s21c1
Sequence:CCGGTCAACCTGGCGGACATCAATGCTCGAGCATTGATGTCCGCCAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004235
VALIDATED
KLF4 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 4 (gut)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004235.3-1388s1c1
Sequence:CCGGGCTCCATTACCAAGAGCTCATCTCGAGATGAGCTCTTGGTAATGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004235.3-1831s1c1
Sequence:CCGGCCAGCCAGAAAGCACTACAATCTCGAGATTGTAGTGCTTTCTGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-615s1c1
Sequence:CCGGCTGGACTTTATTCTCTCCAATCTCGAGATTGGAGAGAATAAAGTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-1716s1c1
Sequence:CCGGGCCTTACACATGAAGAGGCATCTCGAGATGCCTCTTCATGTGTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-917s1c1
Sequence:CCGGGCCAGAATTGGACCCGGTGTACTCGAGTACACCGGGTCCAATTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-2032s21c1
Sequence:GTACCGGTAAATCCCAGACAGTGGATATCTCGAGATATCCACTGTCTGGGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-897s21c1
Sequence:CCGGTCTCCTGGACCTGGACTTTATCTCGAGATAAAGTCCAGGTCCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1773s21c1
Sequence:CCGGCGCCACCCACACTTGTGATTACTCGAGTAATCACAAGTGTGGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004235.4-2320s21c1
Sequence:CCGGTTGTGGATATCAGGGTATAAACTCGAGTTTATACCCTGATATCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1921s21c1
Sequence:CCGGCTGACCAGGCACTACCGTAAACTCGAGTTTACGGTAGTGCCTGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004235
VALIDATED
KLF4 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 4 (gut)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004235.3-1388s1c1
Sequence:CCGGGCTCCATTACCAAGAGCTCATCTCGAGATGAGCTCTTGGTAATGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004235.3-1831s1c1
Sequence:CCGGCCAGCCAGAAAGCACTACAATCTCGAGATTGTAGTGCTTTCTGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-615s1c1
Sequence:CCGGCTGGACTTTATTCTCTCCAATCTCGAGATTGGAGAGAATAAAGTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-1716s1c1
Sequence:CCGGGCCTTACACATGAAGAGGCATCTCGAGATGCCTCTTCATGTGTAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-917s1c1
Sequence:CCGGGCCAGAATTGGACCCGGTGTACTCGAGTACACCGGGTCCAATTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-2032s21c1
Sequence:GTACCGGTAAATCCCAGACAGTGGATATCTCGAGATATCCACTGTCTGGGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-897s21c1
Sequence:CCGGTCTCCTGGACCTGGACTTTATCTCGAGATAAAGTCCAGGTCCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1773s21c1
Sequence:CCGGCGCCACCCACACTTGTGATTACTCGAGTAATCACAAGTGTGGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004235.4-2320s21c1
Sequence:CCGGTTGTGGATATCAGGGTATAAACTCGAGTTTATACCCTGATATCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1921s21c1
Sequence:CCGGCTGACCAGGCACTACCGTAAACTCGAGTTTACGGTAGTGCCTGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004235
VALIDATED
KLF4 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 4 (gut)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004235.3-1388s1c1
Sequence:CCGGGCTCCATTACCAAGAGCTCATCTCGAGATGAGCTCTTGGTAATGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004235.3-1831s1c1
Sequence:CCGGCCAGCCAGAAAGCACTACAATCTCGAGATTGTAGTGCTTTCTGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-615s1c1
Sequence:CCGGCTGGACTTTATTCTCTCCAATCTCGAGATTGGAGAGAATAAAGTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-1716s1c1
Sequence:CCGGGCCTTACACATGAAGAGGCATCTCGAGATGCCTCTTCATGTGTAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004235.3-917s1c1
Sequence:CCGGGCCAGAATTGGACCCGGTGTACTCGAGTACACCGGGTCCAATTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-2032s21c1
Sequence:GTACCGGTAAATCCCAGACAGTGGATATCTCGAGATATCCACTGTCTGGGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-897s21c1
Sequence:CCGGTCTCCTGGACCTGGACTTTATCTCGAGATAAAGTCCAGGTCCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1773s21c1
Sequence:CCGGCGCCACCCACACTTGTGATTACTCGAGTAATCACAAGTGTGGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004235.4-2320s21c1
Sequence:CCGGTTGTGGATATCAGGGTATAAACTCGAGTTTATACCCTGATATCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004235.4-1921s21c1
Sequence:CCGGCTGACCAGGCACTACCGTAAACTCGAGTTTACGGTAGTGCCTGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)