EMAIL THIS PAGE TO A FRIEND

KLF5

Kruppel-like factor 5 (intestinal)

122 Gene Product Result for
Synonyms: BTEB2 CKLF IKLF
UniProtKB ID: Q13887, L0R3U5, L0R4T9, Q9UHP8
Gene ID:
Human(688) Summary: This gene encodes a member of the Kruppel-like factor subfamily of zinc finger proteins. Since the protein localizes to the nucleus and binds the epidermal growth factor response element, it is thought to be a transcription factor. [provided by RefSeq, Jul 2008]
Mouse(12224) Kruppel-like factor 5
Rat(84410) Kruppel-like factor 5
chicken(418818) Kruppel-like factor 5 (intestinal)
domestic cat(101082619) Kruppel-like factor 5 (intestinal)
Horse(100052058) Kruppel-like factor 5 (intestinal)
dog(612788) Kruppel-like factor 5 (intestinal)
cow(535702) Kruppel-like factor 5 (intestinal)
sheep(101123641) Kruppel-like factor 5 (intestinal)
Domestic Rabbit(100008718) Kruppel-like factor 5 (intestinal)
domestic guinea pig(100731965) Kruppel-like factor 5 (intestinal)
naked mole-rat(101721931) Kruppel-like factor 5 (intestinal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040398 Anti-KLF5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701988 Anti-KLF5 antibody produced in rabbit mouse, rat, human
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4200338 Monoclonal Anti-KLF5 antibody produced in mouse ~1.0 mg/mL, clone KLF5-55, purified immunoglobulin mouse, rat, hamster, chicken, human, monkey, canine
immunofluorescence, western blot pricing
SAB1402132 Monoclonal Anti-KLF5, (C-terminal) antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001730 Rosetta Predictions human pricing
NM_053394 Rosetta Predictions rat pricing
NM_009769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058703 predicted 1448
2 SASI_Hs01_00058704 predicted 1320
3 SASI_Hs01_00058705 predicted 1173
4 SASI_Hs01_00058706 predicted 1443
5 SASI_Hs01_00058707 predicted 1016
6 SASI_Hs01_00058708 predicted 1025
7 SASI_Hs02_00332433 predicted 1184
8 SASI_Hs02_00332434 predicted 1386
9 SASI_Hs01_00058709 predicted 1324
10 SASI_Hs01_00058710 predicted 1027
11 SASI_Hs01_00058701 predicted 880
12 SASI_Hs01_00058702 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047738 predicted 1297
2 SASI_Rn01_00047740 predicted 1259
3 SASI_Rn01_00047742 predicted 660
4 SASI_Rn01_00047743 predicted 835
5 SASI_Rn02_00265893 predicted 1206
6 SASI_Rn01_00047744 predicted 578
7 SASI_Rn01_00047745 predicted 1334
8 SASI_Rn01_00047746 predicted 1265
9 SASI_Rn01_00047747 predicted 1384
10 SASI_Rn02_00265894 predicted 1417
11 SASI_Rn01_00047739 predicted 1374
12 SASI_Rn01_00047741 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316973 predicted 1274
2 SASI_Mm01_00158585 predicted 1378
3 SASI_Mm02_00316974 predicted 887
4 SASI_Mm01_00158586 predicted 577
5 SASI_Mm01_00158588 predicted 668
6 SASI_Mm01_00158589 predicted 1241
7 SASI_Mm01_00158590 predicted 1036
8 SASI_Mm01_00158591 predicted 1268
9 SASI_Mm02_00316975 predicted 904
10 SASI_Mm02_00316976 predicted 1416
11 SASI_Mm01_00158583 predicted 533
12 SASI_Mm01_00158584 predicted 661
13 SASI_Mm01_00158587 predicted 705
14 SASI_Mm01_00158592 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001730
VALIDATED
KLF5 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 5 (intestinal)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1361s21c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-634s21c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001730.2-869s1c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1028s21c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1348s1c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-882s21c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1891s1c1
Sequence:CCGGGCTGTAATGTATATGGCTTTACTCGAGTAAAGCCATATACATTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1015s1c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-621s1c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001730
VALIDATED
KLF5 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 5 (intestinal)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1361s21c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-634s21c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001730.2-869s1c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1028s21c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1348s1c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-882s21c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1891s1c1
Sequence:CCGGGCTGTAATGTATATGGCTTTACTCGAGTAAAGCCATATACATTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1015s1c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-621s1c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001730
VALIDATED
KLF5 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 5 (intestinal)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1361s21c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-634s21c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001730.2-869s1c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-1028s21c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1348s1c1
Sequence:CCGGCCCTGCCAGTTAACTCACAAACTCGAGTTTGTGAGTTAACTGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001730.3-882s21c1
Sequence:CCGGCCCTGAGTTCACCAGTATATTCTCGAGAATATACTGGTGAACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1891s1c1
Sequence:CCGGGCTGTAATGTATATGGCTTTACTCGAGTAAAGCCATATACATTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-1015s1c1
Sequence:CCGGCGGATCTAGATATGCCCAGTTCTCGAGAACTGGGCATATCTAGATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001730.2-621s1c1
Sequence:CCGGCCTATAATTCCAGAGCATAAACTCGAGTTTATGCTCTGGAATTATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009769
KLF5 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 5 (intestinal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1383s1c1
Sequence:CCGGCGTATCCACTTCTGCGATTATCTCGAGATAATCGCAGAAGTGGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1257s1c1
Sequence:CCGGGCCGCTACAATTGCTTCCAAACTCGAGTTTGGAAGCAATTGTAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-581s1c1
Sequence:CCGGTCCGATAATTTCAGAGCATAACTCGAGTTATGCTCTGAAATTATCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1281s1c1
Sequence:CCGGGCGATTCACAACCCAAATTTACTCGAGTAAATTTGGGTTGTGAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1023s1c1
Sequence:CCGGGCAGTAATGGACACCCTTAATCTCGAGATTAAGGGTGTCCATTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009769
KLF5 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 5 (intestinal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1383s1c1
Sequence:CCGGCGTATCCACTTCTGCGATTATCTCGAGATAATCGCAGAAGTGGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1257s1c1
Sequence:CCGGGCCGCTACAATTGCTTCCAAACTCGAGTTTGGAAGCAATTGTAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-581s1c1
Sequence:CCGGTCCGATAATTTCAGAGCATAACTCGAGTTATGCTCTGAAATTATCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1281s1c1
Sequence:CCGGGCGATTCACAACCCAAATTTACTCGAGTAAATTTGGGTTGTGAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1023s1c1
Sequence:CCGGGCAGTAATGGACACCCTTAATCTCGAGATTAAGGGTGTCCATTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009769
KLF5 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 5 (intestinal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1383s1c1
Sequence:CCGGCGTATCCACTTCTGCGATTATCTCGAGATAATCGCAGAAGTGGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1257s1c1
Sequence:CCGGGCCGCTACAATTGCTTCCAAACTCGAGTTTGGAAGCAATTGTAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-581s1c1
Sequence:CCGGTCCGATAATTTCAGAGCATAACTCGAGTTATGCTCTGAAATTATCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1281s1c1
Sequence:CCGGGCGATTCACAACCCAAATTTACTCGAGTAAATTTGGGTTGTGAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009769.2-1023s1c1
Sequence:CCGGGCAGTAATGGACACCCTTAATCTCGAGATTAAGGGTGTCCATTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)