EMAIL THIS PAGE TO A FRIEND

KLF7

Kruppel-like factor 7 (ubiquitous)

69 Gene Product Result for
Synonyms: UKLF
Gene ID:
Human(8609) Summary: The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(93691) Kruppel-like factor 7 (ubiquitous)
Rat(363243) Kruppel-like factor 7 (ubiquitous)
chicken(429011) Kruppel-like factor 7 (ubiquitous)
dog(478885) Kruppel-like factor 7 (ubiquitous)
domestic cat(101091038) Kruppel-like factor 7 (ubiquitous)
cow(537747) Kruppel-like factor 7 (ubiquitous)
sheep(101117396) Kruppel-like factor 7 (ubiquitous)
domestic guinea pig(100719439) Kruppel-like factor 7 (ubiquitous)
naked mole-rat(101713832) Kruppel-like factor 7 (ubiquitous)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003709 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020951 MISSION® esiRNA esiRNA targeting mouse Klf7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003709 Rosetta Predictions human pricing
NM_001108800 Rosetta Predictions rat pricing
NM_033563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054115 predicted 428
2 SASI_Hs01_00054116 predicted 962
3 SASI_Hs01_00054117 predicted 1100
4 SASI_Hs02_00336128 predicted 1117
5 SASI_Hs01_00054118 predicted 981
6 SASI_Hs01_00054119 predicted 476
7 SASI_Hs01_00054120 predicted 534
8 SASI_Hs01_00054122 predicted 935
9 SASI_Hs01_00054123 predicted 829
10 SASI_Hs01_00054124 predicted 493
11 SASI_Hs01_00054121 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242195 predicted 1376
2 SASI_Rn02_00242196 predicted 1316
3 SASI_Rn02_00242197 predicted 1451
4 SASI_Rn02_00242198 predicted 1392
5 SASI_Rn02_00242199 predicted 1525
6 SASI_Rn02_00242200 predicted 1397
7 SASI_Rn02_00242201 predicted 1254
8 SASI_Rn02_00242202 predicted 1548
9 SASI_Rn02_00242203 predicted 1654
10 SASI_Rn02_00242204 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170526 predicted 1043
2 SASI_Mm01_00170527 predicted 942
3 SASI_Mm01_00170528 predicted 786
4 SASI_Mm01_00170529 predicted 683
5 SASI_Mm01_00170530 predicted 1026
6 SASI_Mm01_00170531 predicted 874
7 SASI_Mm01_00170532 predicted 539
8 SASI_Mm02_00337392 predicted 950
9 SASI_Mm01_00170533 predicted 487
10 SASI_Mm01_00170534 predicted 758
11 SASI_Mm01_00170535 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033563
VALIDATED
KLF7 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 7 (ubiquitous)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-863s1c1
Sequence:CCGGGATGGCACAGTGACGTTGAAACTCGAGTTTCAACGTCACTGTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-1194s1c1
Sequence:CCGGACAGGAAACACACAGGTGCAACTCGAGTTGCACCTGTGTGTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-589s1c1
Sequence:CCGGCCCATGCATTGAGGAGAGCTTCTCGAGAAGCTCTCCTCAATGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-484s1c1
Sequence:CCGGGCAGCAGACATGCCTTGAGTTCTCGAGAACTCAAGGCATGTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-776s1c1
Sequence:CCGGCTCAACGCAGTGACCTCATTACTCGAGTAATGAGGTCACTGCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-777s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-949s21c1
Sequence:CCGGGACACCAGCTGGAGCAGTTAACTCGAGTTAACTGCTCCAGCTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-1054s21c1
Sequence:CCGGTAACGGGTGCCGGAAAGTTTACTCGAGTAAACTTTCCGGCACCCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-864s21c1
Sequence:CCGGATGGCACAGTGACGTTGAAACCTCGAGGTTTCAACGTCACTGTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-660s21c1
Sequence:CCGGAGAGCTCCGCAGTGGACATTTCTCGAGAAATGTCCACTGCGGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033563
VALIDATED
KLF7 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 7 (ubiquitous)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-863s1c1
Sequence:CCGGGATGGCACAGTGACGTTGAAACTCGAGTTTCAACGTCACTGTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-1194s1c1
Sequence:CCGGACAGGAAACACACAGGTGCAACTCGAGTTGCACCTGTGTGTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-589s1c1
Sequence:CCGGCCCATGCATTGAGGAGAGCTTCTCGAGAAGCTCTCCTCAATGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-484s1c1
Sequence:CCGGGCAGCAGACATGCCTTGAGTTCTCGAGAACTCAAGGCATGTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-776s1c1
Sequence:CCGGCTCAACGCAGTGACCTCATTACTCGAGTAATGAGGTCACTGCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-777s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-949s21c1
Sequence:CCGGGACACCAGCTGGAGCAGTTAACTCGAGTTAACTGCTCCAGCTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-1054s21c1
Sequence:CCGGTAACGGGTGCCGGAAAGTTTACTCGAGTAAACTTTCCGGCACCCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-864s21c1
Sequence:CCGGATGGCACAGTGACGTTGAAACCTCGAGGTTTCAACGTCACTGTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-660s21c1
Sequence:CCGGAGAGCTCCGCAGTGGACATTTCTCGAGAAATGTCCACTGCGGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033563
VALIDATED
KLF7 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 7 (ubiquitous)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-863s1c1
Sequence:CCGGGATGGCACAGTGACGTTGAAACTCGAGTTTCAACGTCACTGTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-1194s1c1
Sequence:CCGGACAGGAAACACACAGGTGCAACTCGAGTTGCACCTGTGTGTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-589s1c1
Sequence:CCGGCCCATGCATTGAGGAGAGCTTCTCGAGAAGCTCTCCTCAATGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-484s1c1
Sequence:CCGGGCAGCAGACATGCCTTGAGTTCTCGAGAACTCAAGGCATGTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033563.2-776s1c1
Sequence:CCGGCTCAACGCAGTGACCTCATTACTCGAGTAATGAGGTCACTGCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-777s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-949s21c1
Sequence:CCGGGACACCAGCTGGAGCAGTTAACTCGAGTTAACTGCTCCAGCTGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-1054s21c1
Sequence:CCGGTAACGGGTGCCGGAAAGTTTACTCGAGTAAACTTTCCGGCACCCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033563.2-864s21c1
Sequence:CCGGATGGCACAGTGACGTTGAAACCTCGAGGTTTCAACGTCACTGTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033563.2-660s21c1
Sequence:CCGGAGAGCTCCGCAGTGGACATTTCTCGAGAAATGTCCACTGCGGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003709
VALIDATED
KLF7 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 7 (ubiquitous)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003709.1-1328s1c1
Sequence:CCGGCGCAGAAGAAAGCTCTCACTTCTCGAGAAGTGAGAGCTTTCTTCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-382s1c1
Sequence:CCGGGCTACTTCTCAGCTTTACCATCTCGAGATGGTAAAGCTGAGAAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-998s1c1
Sequence:CCGGGTGCCGGAAAGTTTATACAAACTCGAGTTTGTATAAACTTTCCGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003709.1-432s1c1
Sequence:CCGGCTTGAATTGGAACGCTACCTACTCGAGTAGGTAGCGTTCCAATTCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-1211s1c1
Sequence:CCGGCCACATGAAGAGACATATCTACTCGAGTAGATATGTCTCTTCATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-993s21c1
Sequence:CCGGACGGGTGCCGGAAAGTTTATACTCGAGTATAAACTTTCCGGCACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-798s21c1
Sequence:CCGGATGGCACGGTGACGTTGAAACCTCGAGGTTTCAACGTCACCGTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-1207s21c1
Sequence:CCGGCCTCCACATGAAGAGACATATCTCGAGATATGTCTCTTCATGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003709.2-1416s21c1
Sequence:CCGGACTGTCATGCACTCAACTATACTCGAGTATAGTTGAGTGCATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-711s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003709
VALIDATED
KLF7 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 7 (ubiquitous)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003709.1-1328s1c1
Sequence:CCGGCGCAGAAGAAAGCTCTCACTTCTCGAGAAGTGAGAGCTTTCTTCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-382s1c1
Sequence:CCGGGCTACTTCTCAGCTTTACCATCTCGAGATGGTAAAGCTGAGAAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-998s1c1
Sequence:CCGGGTGCCGGAAAGTTTATACAAACTCGAGTTTGTATAAACTTTCCGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003709.1-432s1c1
Sequence:CCGGCTTGAATTGGAACGCTACCTACTCGAGTAGGTAGCGTTCCAATTCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-1211s1c1
Sequence:CCGGCCACATGAAGAGACATATCTACTCGAGTAGATATGTCTCTTCATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-993s21c1
Sequence:CCGGACGGGTGCCGGAAAGTTTATACTCGAGTATAAACTTTCCGGCACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-798s21c1
Sequence:CCGGATGGCACGGTGACGTTGAAACCTCGAGGTTTCAACGTCACCGTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-1207s21c1
Sequence:CCGGCCTCCACATGAAGAGACATATCTCGAGATATGTCTCTTCATGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003709.2-1416s21c1
Sequence:CCGGACTGTCATGCACTCAACTATACTCGAGTATAGTTGAGTGCATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-711s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003709
VALIDATED
KLF7 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 7 (ubiquitous)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003709.1-1328s1c1
Sequence:CCGGCGCAGAAGAAAGCTCTCACTTCTCGAGAAGTGAGAGCTTTCTTCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-382s1c1
Sequence:CCGGGCTACTTCTCAGCTTTACCATCTCGAGATGGTAAAGCTGAGAAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-998s1c1
Sequence:CCGGGTGCCGGAAAGTTTATACAAACTCGAGTTTGTATAAACTTTCCGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003709.1-432s1c1
Sequence:CCGGCTTGAATTGGAACGCTACCTACTCGAGTAGGTAGCGTTCCAATTCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003709.1-1211s1c1
Sequence:CCGGCCACATGAAGAGACATATCTACTCGAGTAGATATGTCTCTTCATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-993s21c1
Sequence:CCGGACGGGTGCCGGAAAGTTTATACTCGAGTATAAACTTTCCGGCACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-798s21c1
Sequence:CCGGATGGCACGGTGACGTTGAAACCTCGAGGTTTCAACGTCACCGTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-1207s21c1
Sequence:CCGGCCTCCACATGAAGAGACATATCTCGAGATATGTCTCTTCATGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003709.2-1416s21c1
Sequence:CCGGACTGTCATGCACTCAACTATACTCGAGTATAGTTGAGTGCATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003709.2-711s21c1
Sequence:CCGGTCAACGCAGTGACCTCATTAACTCGAGTTAATGAGGTCACTGCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)