EMAIL THIS PAGE TO A FRIEND

KLF8

Kruppel-like factor 8

90 Gene Product Result for
Synonyms: BKLF3 ZNF741
Gene ID:
Human(11279) Summary: This gene encodes a protein which is a member of the Sp/KLF family of transcription factors. Members of this family contain a C-terminal DNA-binding domain with three Kruppel-like zinc fingers. The encoded protein is thought to play an important role in the regulation of epithelial to mesenchymal transition, a process which occurs normally during development but also during metastasis. A pseudogene has been identified on chromosome 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(245671) Kruppel-like factor 8
Rat(302582) Kruppel-like factor 8
chicken(430697) Kruppel-like factor 8
cow(525558) Kruppel-like factor 8
Horse(100051239) Kruppel-like factor 8
domestic cat(101098120) Kruppel-like factor 8
domestic guinea pig(100724611) Kruppel-like factor 8
naked mole-rat(101704233) Kruppel-like factor 8
sheep(101114934) Kruppel-like factor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108463 Anti-KLF8 affinity isolated antibody horse, canine, human, bovine, rabbit
immunohistochemistry, western blot pricing
SAB2101276 Anti-KLF8 (ab1) antibody produced in rabbit affinity isolated antibody horse, human, mouse, rat, rabbit, guinea pig
western blot pricing
AV31533 Anti-KLF8 (AB1) antibody produced in rabbit affinity isolated antibody canine, rabbit, human, horse, bovine
immunohistochemistry, western blot pricing
SAB2101277 Anti-KLF8 (ab2) antibody produced in rabbit affinity isolated antibody pig, rat, mouse, rabbit, guinea pig, human
western blot pricing
AV32859 Anti-KLF8 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, rat, guinea pig, horse, mouse, human
western blot pricing
SAB1407129 Anti-KLF8 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA071740 Anti-KLF8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2500568 Anti-KLF8/BKLF3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404925 Monoclonal Anti-KLF8, (N-terminal) antibody produced in mouse clone 3F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402540 Monoclonal Anti-KLF8, (N-terminal) antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007250 Rosetta Predictions human pricing
XM_228805 Rosetta Predictions rat pricing
XR_008302 Rosetta Predictions rat pricing
NM_173780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238645 predicted 919
2 SASI_Hs01_00238646 predicted 1453
3 SASI_Hs01_00238647 predicted 861
4 SASI_Hs01_00238648 predicted 1812
5 SASI_Hs01_00238649 predicted 1456
6 SASI_Hs01_00238650 predicted 970
7 SASI_Hs01_00238651 predicted 1674
8 SASI_Hs01_00238652 predicted 1161
9 SASI_Hs01_00238653 predicted 1239
10 SASI_Hs02_00343276 predicted 1698
11 SASI_Hs01_00238654 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181000 predicted 1546
2 SASI_Rn01_00181001 predicted 1350
3 SASI_Rn01_00181002 predicted 1346
4 SASI_Rn01_00181003 predicted 1108
5 SASI_Rn01_00181004 predicted 1291
6 SASI_Rn01_00181005 predicted 1467
7 SASI_Rn01_00181006 predicted 1350
8 SASI_Rn01_00181007 predicted 1226
9 SASI_Rn01_00181008 predicted 1540
10 SASI_Rn01_00181009 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167113 predicted 369
2 SASI_Rn01_00167114 predicted 201
3 SASI_Rn01_00167115 predicted 389
4 SASI_Rn01_00167116 predicted 390
5 SASI_Rn01_00167117 predicted 296
6 SASI_Rn02_00416691 predicted 1341
7 SASI_Rn01_00167119 predicted 355
8 SASI_Rn01_00167120 predicted 304
9 SASI_Rn01_00167121 predicted 349
10 SASI_Rn01_00167122 predicted 275
11 SASI_Rn01_00167118 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139533 predicted 705
2 SASI_Mm01_00139534 predicted 888
3 SASI_Mm01_00139538 predicted 462
4 SASI_Mm01_00139535 predicted 722
5 SASI_Mm01_00139536 predicted 972
6 SASI_Mm01_00139537 predicted 907
7 SASI_Mm01_00139540 predicted 241
8 SASI_Mm01_00139541 predicted 608
9 SASI_Mm01_00139542 predicted 1067
10 SASI_Mm02_00345431 predicted 1168
11 SASI_Mm01_00139539 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173780
KLF8 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-173s21c1
Sequence:CCGGGTTCGATGCAGGTATTCAAACCTCGAGGTTTGAATACCTGCATCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-862s21c1
Sequence:CCGGCATCATGAGCCAGCGACAATGCTCGAGCATTGTCGCTGGCTCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173780.2-1357s1c1
Sequence:CCGGCGGCTCTTCATATTCCACTTTCTCGAGAAAGTGGAATATGAAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-616s1c1
Sequence:CCGGGCCAAATAAGATGAGTGGACTCTCGAGAGTCCACTCATCTTATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-368s1c1
Sequence:CCGGGAACCTGTTGATCTCTCCTTTCTCGAGAAAGGAGAGATCAACAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-617s1c1
Sequence:CCGGCCAAATAAGATGAGTGGACTACTCGAGTAGTCCACTCATCTTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-710s1c1
Sequence:CCGGGCCATTACTGTCCCACTCATTCTCGAGAATGAGTGGGACAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173780
KLF8 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-173s21c1
Sequence:CCGGGTTCGATGCAGGTATTCAAACCTCGAGGTTTGAATACCTGCATCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-862s21c1
Sequence:CCGGCATCATGAGCCAGCGACAATGCTCGAGCATTGTCGCTGGCTCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173780.2-1357s1c1
Sequence:CCGGCGGCTCTTCATATTCCACTTTCTCGAGAAAGTGGAATATGAAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-616s1c1
Sequence:CCGGGCCAAATAAGATGAGTGGACTCTCGAGAGTCCACTCATCTTATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-368s1c1
Sequence:CCGGGAACCTGTTGATCTCTCCTTTCTCGAGAAAGGAGAGATCAACAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-617s1c1
Sequence:CCGGCCAAATAAGATGAGTGGACTACTCGAGTAGTCCACTCATCTTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-710s1c1
Sequence:CCGGGCCATTACTGTCCCACTCATTCTCGAGAATGAGTGGGACAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173780
KLF8 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-173s21c1
Sequence:CCGGGTTCGATGCAGGTATTCAAACCTCGAGGTTTGAATACCTGCATCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173780.4-862s21c1
Sequence:CCGGCATCATGAGCCAGCGACAATGCTCGAGCATTGTCGCTGGCTCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173780.2-1357s1c1
Sequence:CCGGCGGCTCTTCATATTCCACTTTCTCGAGAAAGTGGAATATGAAGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-616s1c1
Sequence:CCGGGCCAAATAAGATGAGTGGACTCTCGAGAGTCCACTCATCTTATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-368s1c1
Sequence:CCGGGAACCTGTTGATCTCTCCTTTCTCGAGAAAGGAGAGATCAACAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-617s1c1
Sequence:CCGGCCAAATAAGATGAGTGGACTACTCGAGTAGTCCACTCATCTTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173780.2-710s1c1
Sequence:CCGGGCCATTACTGTCCCACTCATTCTCGAGAATGAGTGGGACAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007250
KLF8 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007250.4-1901s21c1
Sequence:CCGGGATGAGCTCACTCGCCATTTCCTCGAGGAAATGGCGAGTGAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007250.4-2047s21c1
Sequence:CCGGGAAGCTGCGCTGGTATCTTTCCTCGAGGAAAGATACCAGCGCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007250.2-1818s1c1
Sequence:CCGGCGCTGCTTTATTCTTTCCAATCTCGAGATTGGAAAGAATAAAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1252s1c1
Sequence:CCGGCGGATTCACCAATGTGACTTTCTCGAGAAAGTCACATTGGTGAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-929s1c1
Sequence:CCGGCCTCAGTCAGTCTGCCAAATACTCGAGTATTTGGCAGACTGACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1036s1c1
Sequence:CCGGGCCATTACAGTCCCACTCATTCTCGAGAATGAGTGGGACTGTAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-615s1c1
Sequence:CCGGCCCAGCACTGTTTAATGACATCTCGAGATGTCATTAAACAGTGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007250
KLF8 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007250.4-1901s21c1
Sequence:CCGGGATGAGCTCACTCGCCATTTCCTCGAGGAAATGGCGAGTGAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007250.4-2047s21c1
Sequence:CCGGGAAGCTGCGCTGGTATCTTTCCTCGAGGAAAGATACCAGCGCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007250.2-1818s1c1
Sequence:CCGGCGCTGCTTTATTCTTTCCAATCTCGAGATTGGAAAGAATAAAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1252s1c1
Sequence:CCGGCGGATTCACCAATGTGACTTTCTCGAGAAAGTCACATTGGTGAATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-929s1c1
Sequence:CCGGCCTCAGTCAGTCTGCCAAATACTCGAGTATTTGGCAGACTGACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1036s1c1
Sequence:CCGGGCCATTACAGTCCCACTCATTCTCGAGAATGAGTGGGACTGTAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-615s1c1
Sequence:CCGGCCCAGCACTGTTTAATGACATCTCGAGATGTCATTAAACAGTGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007250
KLF8 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007250.4-1901s21c1
Sequence:CCGGGATGAGCTCACTCGCCATTTCCTCGAGGAAATGGCGAGTGAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007250.4-2047s21c1
Sequence:CCGGGAAGCTGCGCTGGTATCTTTCCTCGAGGAAAGATACCAGCGCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007250.2-1818s1c1
Sequence:CCGGCGCTGCTTTATTCTTTCCAATCTCGAGATTGGAAAGAATAAAGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1252s1c1
Sequence:CCGGCGGATTCACCAATGTGACTTTCTCGAGAAAGTCACATTGGTGAATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-929s1c1
Sequence:CCGGCCTCAGTCAGTCTGCCAAATACTCGAGTATTTGGCAGACTGACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-1036s1c1
Sequence:CCGGGCCATTACAGTCCCACTCATTCTCGAGAATGAGTGGGACTGTAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007250.2-615s1c1
Sequence:CCGGCCCAGCACTGTTTAATGACATCTCGAGATGTCATTAAACAGTGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)