EMAIL THIS PAGE TO A FRIEND

KLF9

Kruppel-like factor 9

224 Gene Product Result for
Synonyms: BTEB BTEB1
UniProtKB ID: Q13886, B2R943, Q16196
Gene ID:
Human(687) Summary: The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]
Mouse(16601) Kruppel-like factor 9
Rat(117560) Kruppel-like factor 9
Zebrafish(565869) Kruppel-like factor 9
dog(484172) Kruppel-like factor 9
chicken(770238) Kruppel-like factor 9
cow(539139) Kruppel-like factor 9
domestic cat(101090808) Kruppel-like factor 9
sheep(101104718) Kruppel-like factor 9
domestic guinea pig(100725215) Kruppel-like factor 9
naked mole-rat(101718843) Kruppel-like factor 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010638 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010638 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010638 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001206 Rosetta Predictions human pricing
NM_057211 Rosetta Predictions rat pricing
NM_010638 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084009 predicted 1893
2 SASI_Hs01_00084010 predicted 1769
3 SASI_Hs01_00084011 predicted 1985
4 SASI_Hs01_00084012 predicted 1588
5 SASI_Hs01_00084013 predicted 1978
6 SASI_Hs01_00084014 predicted 1474
7 SASI_Hs01_00084015 predicted 1765
8 SASI_Hs01_00084016 predicted 1759
9 SASI_Hs01_00084017 predicted 1546
10 SASI_Hs01_00084018 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120662 predicted 701
2 SASI_Rn01_00120663 predicted 1197
3 SASI_Rn01_00120664 predicted 977
4 SASI_Rn01_00120665 predicted 993
5 SASI_Rn01_00120667 predicted 809
6 SASI_Rn01_00120668 predicted 693
7 SASI_Rn01_00120669 predicted 539
8 SASI_Rn02_00267169 predicted 704
9 SASI_Rn01_00120670 predicted 661
10 SASI_Rn01_00120671 predicted 805
11 SASI_Rn01_00120666 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134441 predicted 1320
2 SASI_Mm01_00134442 predicted 723
3 SASI_Mm01_00134443 predicted 1213
4 SASI_Mm01_00134445 predicted 1009
5 SASI_Mm02_00318988 predicted 1303
6 SASI_Mm01_00134446 predicted 819
7 SASI_Mm01_00134447 predicted 1127
8 SASI_Mm01_00134448 predicted 1327
9 SASI_Mm01_00134449 predicted 677
10 SASI_Mm01_00134450 predicted 823
11 SASI_Mm01_00134444 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001206
KLF9 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001206.1-2752s1c1
Sequence:CCGGGCTTTGTATGAGTTGTACTTTCTCGAGAAAGTACAACTCATACAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1514s1c1
Sequence:CCGGGACAGTCTGGAAAGTCCAGATCTCGAGATCTGGACTTTCCAGACTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1299s1c1
Sequence:CCGGCCCAGTGTCTGGTTTCCATTTCTCGAGAAATGGAAACCAGACACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1735s1c1
Sequence:CCGGCTCCCATCTCAAAGCCCATTACTCGAGTAATGGGCTTTGAGATGGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1955s1c1
Sequence:CCGGAGCATGATCAAGCGATCGAAACTCGAGTTTCGATCGCTTGATCATGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2206s21c1
Sequence:CCGGGTAGCCTAAGATCAAAGTCAACTCGAGTTGACTTTGATCTTAGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001206.2-1463s21c1
Sequence:CCGGTACTGCACACTGGTCACCATCCTCGAGGATGGTGACCAGTGTGCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2469s21c1
Sequence:CCGGAGTGATTCTGGGCCCTTTATGCTCGAGCATAAAGGGCCCAGAATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001206
KLF9 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001206.1-2752s1c1
Sequence:CCGGGCTTTGTATGAGTTGTACTTTCTCGAGAAAGTACAACTCATACAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1514s1c1
Sequence:CCGGGACAGTCTGGAAAGTCCAGATCTCGAGATCTGGACTTTCCAGACTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1299s1c1
Sequence:CCGGCCCAGTGTCTGGTTTCCATTTCTCGAGAAATGGAAACCAGACACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1735s1c1
Sequence:CCGGCTCCCATCTCAAAGCCCATTACTCGAGTAATGGGCTTTGAGATGGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1955s1c1
Sequence:CCGGAGCATGATCAAGCGATCGAAACTCGAGTTTCGATCGCTTGATCATGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2206s21c1
Sequence:CCGGGTAGCCTAAGATCAAAGTCAACTCGAGTTGACTTTGATCTTAGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001206.2-1463s21c1
Sequence:CCGGTACTGCACACTGGTCACCATCCTCGAGGATGGTGACCAGTGTGCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2469s21c1
Sequence:CCGGAGTGATTCTGGGCCCTTTATGCTCGAGCATAAAGGGCCCAGAATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001206
KLF9 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001206.1-2752s1c1
Sequence:CCGGGCTTTGTATGAGTTGTACTTTCTCGAGAAAGTACAACTCATACAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1514s1c1
Sequence:CCGGGACAGTCTGGAAAGTCCAGATCTCGAGATCTGGACTTTCCAGACTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1299s1c1
Sequence:CCGGCCCAGTGTCTGGTTTCCATTTCTCGAGAAATGGAAACCAGACACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1735s1c1
Sequence:CCGGCTCCCATCTCAAAGCCCATTACTCGAGTAATGGGCTTTGAGATGGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001206.1-1955s1c1
Sequence:CCGGAGCATGATCAAGCGATCGAAACTCGAGTTTCGATCGCTTGATCATGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2206s21c1
Sequence:CCGGGTAGCCTAAGATCAAAGTCAACTCGAGTTGACTTTGATCTTAGGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001206.2-1463s21c1
Sequence:CCGGTACTGCACACTGGTCACCATCCTCGAGGATGGTGACCAGTGTGCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001206.2-2469s21c1
Sequence:CCGGAGTGATTCTGGGCCCTTTATGCTCGAGCATAAAGGGCCCAGAATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010638
KLF9 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010638.2-2080s1c1
Sequence:CCGGCGAGGGTGAATACGGTAAATACTCGAGTATTTACCGTATTCACCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1221s1c1
Sequence:CCGGCCAGCATGATCAAGAGATCAACTCGAGTTGATCTCTTGATCATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-728s1c1
Sequence:CCGGAGCTTGTTGGACCTCAACAAACTCGAGTTTGTTGAGGTCCAACAAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-978s1c1
Sequence:CCGGGCTGTGGGAAAGTCTATGGAACTCGAGTTCCATAGACTTTCCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1002s1c1
Sequence:CCGGCCTCCCATCTTAAAGCCCATTCTCGAGAATGGGCTTTAAGATGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010638.4-1433s21c1
Sequence:CCGGATGGTAGCCCTAAGGTCAAAGCTCGAGCTTTGACCTTAGGGCTACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010638.4-789s21c1
Sequence:CCGGAGAGTCCCGATGAGGATATAGCTCGAGCTATATCCTCATCGGGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010638
KLF9 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010638.2-2080s1c1
Sequence:CCGGCGAGGGTGAATACGGTAAATACTCGAGTATTTACCGTATTCACCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1221s1c1
Sequence:CCGGCCAGCATGATCAAGAGATCAACTCGAGTTGATCTCTTGATCATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-728s1c1
Sequence:CCGGAGCTTGTTGGACCTCAACAAACTCGAGTTTGTTGAGGTCCAACAAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-978s1c1
Sequence:CCGGGCTGTGGGAAAGTCTATGGAACTCGAGTTCCATAGACTTTCCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1002s1c1
Sequence:CCGGCCTCCCATCTTAAAGCCCATTCTCGAGAATGGGCTTTAAGATGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010638.4-1433s21c1
Sequence:CCGGATGGTAGCCCTAAGGTCAAAGCTCGAGCTTTGACCTTAGGGCTACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010638.4-789s21c1
Sequence:CCGGAGAGTCCCGATGAGGATATAGCTCGAGCTATATCCTCATCGGGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010638
KLF9 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010638.2-2080s1c1
Sequence:CCGGCGAGGGTGAATACGGTAAATACTCGAGTATTTACCGTATTCACCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1221s1c1
Sequence:CCGGCCAGCATGATCAAGAGATCAACTCGAGTTGATCTCTTGATCATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-728s1c1
Sequence:CCGGAGCTTGTTGGACCTCAACAAACTCGAGTTTGTTGAGGTCCAACAAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-978s1c1
Sequence:CCGGGCTGTGGGAAAGTCTATGGAACTCGAGTTCCATAGACTTTCCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010638.2-1002s1c1
Sequence:CCGGCCTCCCATCTTAAAGCCCATTCTCGAGAATGGGCTTTAAGATGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010638.4-1433s21c1
Sequence:CCGGATGGTAGCCCTAAGGTCAAAGCTCGAGCTTTGACCTTAGGGCTACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010638.4-789s21c1
Sequence:CCGGAGAGTCCCGATGAGGATATAGCTCGAGCTATATCCTCATCGGGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)