EMAIL THIS PAGE TO A FRIEND

KLHDC2

kelch domain containing 2

64 Gene Product Result for
Synonyms: HCLP-1 HCLP1 LCP
UniProtKB ID: Q9Y2U9, B3KPF9, Q6IAF0, Q86TY9
Gene ID:
Mouse(69554) kelch domain containing 2
Rat(299113) kelch domain containing 2
domestic guinea pig(100719793) kelch domain containing 2
naked mole-rat(101703403) kelch domain containing 2
sheep(101120247) kelch domain containing 2
Domestic Rabbit(100349692) kelch domain containing 2
chicken(423569) kelch domain containing 2
cow(535436) kelch domain containing 2
domestic cat(101088337) kelch domain containing 2
dog(480314) kelch domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014315 Rosetta Predictions human pricing
NM_001034133 Rosetta Predictions rat pricing
NM_027117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345409 predicted 664
2 SASI_Hs01_00109723 predicted 832
3 SASI_Hs01_00109724 predicted 959
4 SASI_Hs01_00109725 predicted 1011
5 SASI_Hs01_00109726 predicted 742
6 SASI_Hs01_00109727 predicted 1116
7 SASI_Hs02_00345410 predicted 1270
8 SASI_Hs02_00345411 predicted 1241
9 SASI_Hs01_00109729 predicted 1257
10 SASI_Hs01_00109730 predicted 1569
11 SASI_Hs01_00109722 predicted 656
12 SASI_Hs01_00109728 predicted 906
13 SASI_Hs01_00109731 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116979 predicted 871
2 SASI_Rn01_00116980 predicted 1332
3 SASI_Rn01_00116981 predicted 1216
4 SASI_Rn01_00116984 predicted 888
5 SASI_Rn01_00116985 predicted 675
6 SASI_Rn01_00116986 predicted 1350
7 SASI_Rn01_00116987 predicted 325
8 SASI_Rn02_00203980 predicted 403
9 SASI_Rn01_00116988 predicted 1095
10 SASI_Rn02_00203981 predicted 412
11 SASI_Rn01_00116982 predicted 1054
12 SASI_Rn01_00116983 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184199 predicted 1271
2 SASI_Mm01_00184200 predicted 1388
3 SASI_Mm02_00331564 predicted 1098
4 SASI_Mm01_00184201 predicted 1402
5 SASI_Mm01_00184202 predicted 708
6 SASI_Mm01_00184203 predicted 720
7 SASI_Mm02_00331565 predicted 565
8 SASI_Mm01_00184205 predicted 948
9 SASI_Mm01_00184207 predicted 787
10 SASI_Mm01_00184208 predicted 906
11 SASI_Mm01_00184204 predicted 783
12 SASI_Mm01_00184206 predicted 1284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014315
VALIDATED
KLHDC2 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-460s1c1
Sequence:CCGGCGGCTACAAGAGTAATCAAGTCTCGAGACTTGATTACTCTTGTAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-723s21c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1207s1c1
Sequence:CCGGCTGGACTTACTGCATCAGTAACTCGAGTTACTGATGCAGTAAGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-563s21c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-479s1c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-740s1c1
Sequence:CCGGCCATCATCAAAGGACAAACTTCTCGAGAAGTTTGTCCTTTGATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-639s1c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-1179s1c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1331s1c1
Sequence:CCGGGCCAACAACTTGCTTGTCCATCTCGAGATGGACAAGCAAGTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1293s1c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1377s21c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1263s21c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014315
VALIDATED
KLHDC2 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-460s1c1
Sequence:CCGGCGGCTACAAGAGTAATCAAGTCTCGAGACTTGATTACTCTTGTAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-723s21c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1207s1c1
Sequence:CCGGCTGGACTTACTGCATCAGTAACTCGAGTTACTGATGCAGTAAGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-563s21c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-479s1c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-740s1c1
Sequence:CCGGCCATCATCAAAGGACAAACTTCTCGAGAAGTTTGTCCTTTGATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-639s1c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-1179s1c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1331s1c1
Sequence:CCGGGCCAACAACTTGCTTGTCCATCTCGAGATGGACAAGCAAGTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1293s1c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1377s21c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1263s21c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014315
VALIDATED
KLHDC2 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-460s1c1
Sequence:CCGGCGGCTACAAGAGTAATCAAGTCTCGAGACTTGATTACTCTTGTAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-723s21c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1207s1c1
Sequence:CCGGCTGGACTTACTGCATCAGTAACTCGAGTTACTGATGCAGTAAGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-563s21c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-479s1c1
Sequence:CCGGGTCAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-740s1c1
Sequence:CCGGCCATCATCAAAGGACAAACTTCTCGAGAAGTTTGTCCTTTGATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-639s1c1
Sequence:CCGGGACACCATTCAAGAGGCAATACTCGAGTATTGCCTCTTGAATGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014315.1-1179s1c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1331s1c1
Sequence:CCGGGCCAACAACTTGCTTGTCCATCTCGAGATGGACAAGCAAGTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014315.1-1293s1c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1377s21c1
Sequence:CCGGCCAGCGATGAAGGAGAAGTAACTCGAGTTACTTCTCCTTCATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014315.2-1263s21c1
Sequence:CCGGCCACTGATAAACAGCCACTAACTCGAGTTAGTGGCTGTTTATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027117
VALIDATED
KLHDC2 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-706s21c1
Sequence:CCGGTTTGGAGGCTATGGATATTTACTCGAGTAAATATCCATAGCCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1393s21c1
Sequence:CCGGCACTTACTTCACAGCGTTAATCTCGAGATTAACGCTGTGAAGTAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-800s21c1
Sequence:CCGGGGAATGATCATGTCCATATTTCTCGAGAAATATGGACATGATCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-392s1c1
Sequence:CCGGGTGAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-650s1c1
Sequence:CCGGCCTCCATCATCAAAGGACAAACTCGAGTTTGTCCTTTGATGATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-649s1c1
Sequence:CCGGCCCTCCATCATCAAAGGACAACTCGAGTTGTCCTTTGATGATGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.2-954s1c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1463s21c1
Sequence:CCGGATACTTCTTCTGGTCCACTTGCTCGAGCAAGTGGACCAGAAGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-954s21c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027117
VALIDATED
KLHDC2 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-706s21c1
Sequence:CCGGTTTGGAGGCTATGGATATTTACTCGAGTAAATATCCATAGCCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1393s21c1
Sequence:CCGGCACTTACTTCACAGCGTTAATCTCGAGATTAACGCTGTGAAGTAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-800s21c1
Sequence:CCGGGGAATGATCATGTCCATATTTCTCGAGAAATATGGACATGATCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-392s1c1
Sequence:CCGGGTGAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-650s1c1
Sequence:CCGGCCTCCATCATCAAAGGACAAACTCGAGTTTGTCCTTTGATGATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-649s1c1
Sequence:CCGGCCCTCCATCATCAAAGGACAACTCGAGTTGTCCTTTGATGATGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.2-954s1c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1463s21c1
Sequence:CCGGATACTTCTTCTGGTCCACTTGCTCGAGCAAGTGGACCAGAAGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-954s21c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027117
VALIDATED
KLHDC2 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-706s21c1
Sequence:CCGGTTTGGAGGCTATGGATATTTACTCGAGTAAATATCCATAGCCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1393s21c1
Sequence:CCGGCACTTACTTCACAGCGTTAATCTCGAGATTAACGCTGTGAAGTAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-800s21c1
Sequence:CCGGGGAATGATCATGTCCATATTTCTCGAGAAATATGGACATGATCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-392s1c1
Sequence:CCGGGTGAGAGGATTATATGACTTTCTCGAGAAAGTCATATAATCCTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-650s1c1
Sequence:CCGGCCTCCATCATCAAAGGACAAACTCGAGTTTGTCCTTTGATGATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.1-649s1c1
Sequence:CCGGCCCTCCATCATCAAAGGACAACTCGAGTTGTCCTTTGATGATGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027117.2-954s1c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-1463s21c1
Sequence:CCGGATACTTCTTCTGGTCCACTTGCTCGAGCAAGTGGACCAGAAGAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027117.2-954s21c1
Sequence:CCGGGAATGATCTTCACTATCTTAACTCGAGTTAAGATAGTGAAGATCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)