EMAIL THIS PAGE TO A FRIEND

KLHDC3

kelch domain containing 3

157 Gene Product Result for
Synonyms: PEAS RP1-20C7.3 dJ20C7.3
UniProtKB ID: Q9BQ90, A8K2W9
Gene ID:
Human(116138) Summary: The protein encoded by this gene contains six repeated kelch motifs that are structurally similar to recombination activating gene 2, a protein involved in the activation of the V(D)J recombination. In mouse, this gene is found to be expressed specifically in testis. Its expression in pachytene spermatocytes is localized to cytoplasma and meiotic chromatin, suggesting that this gene may be involved in meiotic recombination. [provided by RefSeq, Jun 2012]
Mouse(71765) kelch domain containing 3
Rat(363192) kelch domain containing 3
chicken(421251) kelch domain containing 3
cow(541138) kelch domain containing 3
domestic cat(101083849) kelch domain containing 3
dog(474907) kelch domain containing 3
sheep(101112265) kelch domain containing 3
domestic guinea pig(100735115) kelch domain containing 3
naked mole-rat(101722415) kelch domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_057161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057161 Rosetta Predictions human pricing
NM_001012203 Rosetta Predictions rat pricing
NM_027910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159962 predicted 1047
2 SASI_Hs01_00159963 predicted 483
3 SASI_Hs01_00159964 predicted 1160
4 SASI_Hs01_00159965 predicted 1235
5 SASI_Hs01_00159966 predicted 473
6 SASI_Hs01_00159967 predicted 915
7 SASI_Hs01_00159968 predicted 1228
8 SASI_Hs01_00159969 predicted 719
9 SASI_Hs01_00159970 predicted 625
10 SASI_Hs02_00362017 predicted 1194
11 SASI_Hs01_00159971 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101702 predicted 1177
2 SASI_Rn01_00101703 predicted 934
3 SASI_Rn01_00101704 predicted 597
4 SASI_Rn02_00200441 predicted 1309
5 SASI_Rn02_00200442 predicted 1070
6 SASI_Rn01_00101706 predicted 789
7 SASI_Rn01_00101707 predicted 843
8 SASI_Rn01_00101708 predicted 1266
9 SASI_Rn01_00101709 predicted 916
10 SASI_Rn01_00101710 predicted 412
11 SASI_Rn01_00101705 predicted 1195
12 SASI_Rn01_00101711 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054430 predicted 1057
2 SASI_Mm01_00054431 predicted 1039
3 SASI_Mm01_00054432 predicted 1406
4 SASI_Mm01_00054434 predicted 1294
5 SASI_Mm02_00332886 predicted 1129
6 SASI_Mm01_00054435 predicted 1647
7 SASI_Mm01_00054436 predicted 1148
8 SASI_Mm01_00054437 predicted 961
9 SASI_Mm01_00054438 predicted 1484
10 SASI_Mm01_00054439 predicted 1016
11 SASI_Mm01_00054433 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027910
VALIDATED
KLHDC3 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1007s21c1
Sequence:CCGGGCAATCACATGTATGTCTTTGCTCGAGCAAAGACATACATGTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-736s1c1
Sequence:CCGGCGCCTTTGATGTCAATACTCACTCGAGTGAGTATTGACATCAAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-823s1c1
Sequence:CCGGCCTGGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-909s1c1
Sequence:CCGGCCATGACATGGGCTCTTGTTTCTCGAGAAACAAGAGCCCATGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.2-1023s1c1
Sequence:CCGGGGCCATTTCATTCCAACAATGCTCGAGCATTGTTGGAATGAAATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1238s21c1
Sequence:CCGGATGACCTCTGGAAGTTTAATCCTCGAGGATTAAACTTCCAGAGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1142s1c1
Sequence:CCGGCATTCAGCCTTTGGCTACAATCTCGAGATTGTAGCCAAAGGCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1376s1c1
Sequence:CCGGGAATTTGACCTCATAGATCATCTCGAGATGATCTATGAGGTCAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027910
VALIDATED
KLHDC3 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1007s21c1
Sequence:CCGGGCAATCACATGTATGTCTTTGCTCGAGCAAAGACATACATGTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-736s1c1
Sequence:CCGGCGCCTTTGATGTCAATACTCACTCGAGTGAGTATTGACATCAAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-823s1c1
Sequence:CCGGCCTGGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-909s1c1
Sequence:CCGGCCATGACATGGGCTCTTGTTTCTCGAGAAACAAGAGCCCATGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.2-1023s1c1
Sequence:CCGGGGCCATTTCATTCCAACAATGCTCGAGCATTGTTGGAATGAAATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1238s21c1
Sequence:CCGGATGACCTCTGGAAGTTTAATCCTCGAGGATTAAACTTCCAGAGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1142s1c1
Sequence:CCGGCATTCAGCCTTTGGCTACAATCTCGAGATTGTAGCCAAAGGCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1376s1c1
Sequence:CCGGGAATTTGACCTCATAGATCATCTCGAGATGATCTATGAGGTCAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027910
VALIDATED
KLHDC3 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1007s21c1
Sequence:CCGGGCAATCACATGTATGTCTTTGCTCGAGCAAAGACATACATGTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-736s1c1
Sequence:CCGGCGCCTTTGATGTCAATACTCACTCGAGTGAGTATTGACATCAAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-823s1c1
Sequence:CCGGCCTGGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.1-909s1c1
Sequence:CCGGCCATGACATGGGCTCTTGTTTCTCGAGAAACAAGAGCCCATGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027910.2-1023s1c1
Sequence:CCGGGGCCATTTCATTCCAACAATGCTCGAGCATTGTTGGAATGAAATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027910.3-1238s21c1
Sequence:CCGGATGACCTCTGGAAGTTTAATCCTCGAGGATTAAACTTCCAGAGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1142s1c1
Sequence:CCGGCATTCAGCCTTTGGCTACAATCTCGAGATTGTAGCCAAAGGCTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027910.1-1376s1c1
Sequence:CCGGGAATTTGACCTCATAGATCATCTCGAGATGATCTATGAGGTCAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057161
KLHDC3 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-294s1c1
Sequence:CCGGGTCAGATAGATGTGCACATTTCTCGAGAAATGTGCACATCTATCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1135s1c1
Sequence:CCGGCCTTATAGATCATTCTGACTTCTCGAGAAGTCAGAATGATCTATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-797s1c1
Sequence:CCGGGAGATTTACTGCAACCGCATTCTCGAGAATGCGGTTGCAGTAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1202s1c1
Sequence:CCGGGCCGTGATTCAGTATAACCTACTCGAGTAGGTTATACTGAATCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-293s1c1
Sequence:CCGGCGTCAGATAGATGTGCACATTCTCGAGAATGTGCACATCTATCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1267s1c1
Sequence:CCGGCATGACCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-818s1c1
Sequence:CCGGCGAGTCTTTGACACCAGAACTCTCGAGAGTTCTGGTGTCAAAGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-574s1c1
Sequence:CCGGCCTAGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-976s1c1
Sequence:CCGGGAAGTTTAATCCTGTGTCCTTCTCGAGAAGGACACAGGATTAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1204s1c1
Sequence:CCGGCGTGATTCAGTATAACCTAGACTCGAGTCTAGGTTATACTGAATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-657s1c1
Sequence:CCGGGCACCATGACATGGACTCTTACTCGAGTAAGAGTCCATGTCATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057161
KLHDC3 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-294s1c1
Sequence:CCGGGTCAGATAGATGTGCACATTTCTCGAGAAATGTGCACATCTATCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1135s1c1
Sequence:CCGGCCTTATAGATCATTCTGACTTCTCGAGAAGTCAGAATGATCTATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-797s1c1
Sequence:CCGGGAGATTTACTGCAACCGCATTCTCGAGAATGCGGTTGCAGTAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1202s1c1
Sequence:CCGGGCCGTGATTCAGTATAACCTACTCGAGTAGGTTATACTGAATCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-293s1c1
Sequence:CCGGCGTCAGATAGATGTGCACATTCTCGAGAATGTGCACATCTATCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1267s1c1
Sequence:CCGGCATGACCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-818s1c1
Sequence:CCGGCGAGTCTTTGACACCAGAACTCTCGAGAGTTCTGGTGTCAAAGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-574s1c1
Sequence:CCGGCCTAGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-976s1c1
Sequence:CCGGGAAGTTTAATCCTGTGTCCTTCTCGAGAAGGACACAGGATTAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1204s1c1
Sequence:CCGGCGTGATTCAGTATAACCTAGACTCGAGTCTAGGTTATACTGAATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-657s1c1
Sequence:CCGGGCACCATGACATGGACTCTTACTCGAGTAAGAGTCCATGTCATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057161
KLHDC3 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-294s1c1
Sequence:CCGGGTCAGATAGATGTGCACATTTCTCGAGAAATGTGCACATCTATCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1135s1c1
Sequence:CCGGCCTTATAGATCATTCTGACTTCTCGAGAAGTCAGAATGATCTATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-797s1c1
Sequence:CCGGGAGATTTACTGCAACCGCATTCTCGAGAATGCGGTTGCAGTAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1202s1c1
Sequence:CCGGGCCGTGATTCAGTATAACCTACTCGAGTAGGTTATACTGAATCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-293s1c1
Sequence:CCGGCGTCAGATAGATGTGCACATTCTCGAGAATGTGCACATCTATCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1267s1c1
Sequence:CCGGCATGACCACCAACAGCAATATCTCGAGATATTGCTGTTGGTGGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-818s1c1
Sequence:CCGGCGAGTCTTTGACACCAGAACTCTCGAGAGTTCTGGTGTCAAAGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-574s1c1
Sequence:CCGGCCTAGGCAAGATCATGTACATCTCGAGATGTACATGATCTTGCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-976s1c1
Sequence:CCGGGAAGTTTAATCCTGTGTCCTTCTCGAGAAGGACACAGGATTAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-1204s1c1
Sequence:CCGGCGTGATTCAGTATAACCTAGACTCGAGTCTAGGTTATACTGAATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057161.2-657s1c1
Sequence:CCGGGCACCATGACATGGACTCTTACTCGAGTAAGAGTCCATGTCATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)