EMAIL THIS PAGE TO A FRIEND

KLHDC7A

kelch domain containing 7A

72 Gene Product Result for
Synonyms: RP11-422P22.2
UniProtKB ID: Q5VTJ3, Q8N8W6
Gene ID:
Mouse(242721) kelch domain containing 7A
Rat(298590) kelch domain containing 7A
sheep(101110125) kelch domain containing 7A
domestic guinea pig(100726396) kelch domain containing 7A
naked mole-rat(101696383) kelch domain containing 7A
chicken(428170) kelch domain containing 7A
domestic cat(101087500) kelch domain containing 7A
cow(530171) kelch domain containing 7A
Horse(100068839) kelch domain containing 7A
dog(487409) kelch domain containing 7A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056616 Anti-KLHDC7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152375 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058111 MISSION® esiRNA esiRNA human KLHDC7A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152375 Rosetta Predictions human pricing
XM_233599 Rosetta Predictions rat pricing
XR_008781 Rosetta Predictions rat pricing
NM_173427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366026 predicted 480
2 SASI_Hs01_00051468 predicted 2386
3 SASI_Hs01_00051469 predicted 1063
4 SASI_Hs01_00051470 predicted 919
5 SASI_Hs01_00051471 predicted 2174
6 SASI_Hs01_00051472 predicted 2166
7 SASI_Hs01_00051473 predicted 2495
8 SASI_Hs02_00366027 predicted 2876
9 SASI_Hs02_00366028 predicted 663
10 SASI_Hs01_00051474 predicted 2362
11 SASI_Hs01_00051475 predicted 1617
12 SASI_Hs01_00051476 predicted 918
13 SASI_Hs01_00051477 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139269 predicted 1019
2 SASI_Rn01_00139270 predicted 1094
3 SASI_Rn01_00139271 predicted 1026
4 SASI_Rn01_00139272 predicted 1093
5 SASI_Rn01_00139273 predicted 1013
6 SASI_Rn01_00139274 predicted 1086
7 SASI_Rn01_00139275 predicted 1077
8 SASI_Rn01_00139276 predicted 1038
9 SASI_Rn01_00139277 predicted 1020
10 SASI_Rn01_00139278 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00417896 predicted 1308
2 SASI_Rn02_00417897 predicted 1605
3 SASI_Rn01_00144735 predicted 2100
4 SASI_Rn02_00417898 predicted 1877
5 SASI_Rn01_00144736 predicted 2209
6 SASI_Rn02_00417899 predicted 739
7 SASI_Rn02_00417900 predicted 1184
8 SASI_Rn01_00144739 predicted 2163
9 SASI_Rn02_00417901 predicted 979
10 SASI_Rn01_00144740 predicted 1319
11 SASI_Rn01_00144734 predicted 2028
12 SASI_Rn01_00144737 predicted 1458
13 SASI_Rn01_00144738 predicted 1438
14 SASI_Rn01_00144741 predicted 1392
15 SASI_Rn01_00144742 predicted 2085
16 SASI_Rn01_00144743 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134010 predicted 1600
2 SASI_Mm02_00345306 predicted 2760
3 SASI_Mm02_00345307 predicted 487
4 SASI_Mm02_00345308 predicted 1986
5 SASI_Mm01_00134013 predicted 821
6 SASI_Mm02_00345309 predicted 2303
7 SASI_Mm01_00134014 predicted 1681
8 SASI_Mm02_00345310 predicted 1740
9 SASI_Mm02_00345311 predicted 2480
10 SASI_Mm02_00345312 predicted 2617
11 SASI_Mm01_00134011 predicted 437
12 SASI_Mm01_00134012 predicted 1733
13 SASI_Mm01_00134015 predicted 437
14 SASI_Mm01_00134016 predicted 1049
15 SASI_Mm01_00134017 predicted 732
16 SASI_Mm01_00134018 predicted 1177
17 SASI_Mm01_00134019 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173427
KLHDC7A MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 7A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173427.2-3915s21c1
Sequence:CCGGCCTGGACACTGTCACTATAAACTCGAGTTTATAGTGACAGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.2-2229s1c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2534s21c1
Sequence:CCGGCGCCGTTGTGGATGATCATATCTCGAGATATGATCATCCACAACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-66s1c1
Sequence:CCGGCGGCTTACAAACTCTACAAGTCTCGAGACTTGTAGAGTTTGTAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2229s21c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1240s21c1
Sequence:CCGGAGGGCAGAGTATATGACTATTCTCGAGAATAGTCATATACTCTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1155s21c1
Sequence:CCGGACCAACGCCTCCCATACTTTCCTCGAGGAAAGTATGGGAGGCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-1550s1c1
Sequence:CCGGGCACTCTGTACCCTATTCAATCTCGAGATTGAATAGGGTACAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173427.1-2076s1c1
Sequence:CCGGCTTACCTTACCCTGATGCCTTCTCGAGAAGGCATCAGGGTAAGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173427
KLHDC7A MISSION shRNA shRNA Plasmid DNA
kelch domain containing 7A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173427.2-3915s21c1
Sequence:CCGGCCTGGACACTGTCACTATAAACTCGAGTTTATAGTGACAGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.2-2229s1c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2534s21c1
Sequence:CCGGCGCCGTTGTGGATGATCATATCTCGAGATATGATCATCCACAACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-66s1c1
Sequence:CCGGCGGCTTACAAACTCTACAAGTCTCGAGACTTGTAGAGTTTGTAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2229s21c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1240s21c1
Sequence:CCGGAGGGCAGAGTATATGACTATTCTCGAGAATAGTCATATACTCTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1155s21c1
Sequence:CCGGACCAACGCCTCCCATACTTTCCTCGAGGAAAGTATGGGAGGCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-1550s1c1
Sequence:CCGGGCACTCTGTACCCTATTCAATCTCGAGATTGAATAGGGTACAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173427.1-2076s1c1
Sequence:CCGGCTTACCTTACCCTGATGCCTTCTCGAGAAGGCATCAGGGTAAGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173427
KLHDC7A MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 7A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173427.2-3915s21c1
Sequence:CCGGCCTGGACACTGTCACTATAAACTCGAGTTTATAGTGACAGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.2-2229s1c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2534s21c1
Sequence:CCGGCGCCGTTGTGGATGATCATATCTCGAGATATGATCATCCACAACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-66s1c1
Sequence:CCGGCGGCTTACAAACTCTACAAGTCTCGAGACTTGTAGAGTTTGTAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-2229s21c1
Sequence:CCGGCCTCTCCCAAACGATACATTTCTCGAGAAATGTATCGTTTGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1240s21c1
Sequence:CCGGAGGGCAGAGTATATGACTATTCTCGAGAATAGTCATATACTCTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173427.2-1155s21c1
Sequence:CCGGACCAACGCCTCCCATACTTTCCTCGAGGAAAGTATGGGAGGCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173427.1-1550s1c1
Sequence:CCGGGCACTCTGTACCCTATTCAATCTCGAGATTGAATAGGGTACAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173427.1-2076s1c1
Sequence:CCGGCTTACCTTACCCTGATGCCTTCTCGAGAAGGCATCAGGGTAAGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152375
KLHDC7A MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 7A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-2100s1c1
Sequence:CCGGGAGGGATCTTAGATGAGTCTTCTCGAGAAGACTCATCTAAGATCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-486s1c1
Sequence:CCGGCTATGTGGAATCTACCTCTCACTCGAGTGAGAGGTAGATTCCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1131s1c1
Sequence:CCGGCCTCTGTTGCTATGACGATGACTCGAGTCATCGTCATAGCAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-971s1c1
Sequence:CCGGCCTACAAGGTGATGAGCGAAACTCGAGTTTCGCTCATCACCTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1211s1c1
Sequence:CCGGCCATCTGCAGTCTCTTCAATTCTCGAGAATTGAAGAGACTGCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-426s1c1
Sequence:CCGGGAATTTCATACAGAAGGCGGACTCGAGTCCGCCTTCTGTATGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-908s1c1
Sequence:CCGGGCAATTGCTATGAGGTGCTGACTCGAGTCAGCACCTCATAGCAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-415s1c1
Sequence:CCGGCGAATGGAGGAGAATTTCATACTCGAGTATGAAATTCTCCTCCATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-475s1c1
Sequence:CCGGGTGTACGACTACTATGTGGAACTCGAGTTCCACATAGTAGTCGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152375
KLHDC7A MISSION shRNA shRNA Plasmid DNA
kelch domain containing 7A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-2100s1c1
Sequence:CCGGGAGGGATCTTAGATGAGTCTTCTCGAGAAGACTCATCTAAGATCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-486s1c1
Sequence:CCGGCTATGTGGAATCTACCTCTCACTCGAGTGAGAGGTAGATTCCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1131s1c1
Sequence:CCGGCCTCTGTTGCTATGACGATGACTCGAGTCATCGTCATAGCAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-971s1c1
Sequence:CCGGCCTACAAGGTGATGAGCGAAACTCGAGTTTCGCTCATCACCTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1211s1c1
Sequence:CCGGCCATCTGCAGTCTCTTCAATTCTCGAGAATTGAAGAGACTGCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-426s1c1
Sequence:CCGGGAATTTCATACAGAAGGCGGACTCGAGTCCGCCTTCTGTATGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-908s1c1
Sequence:CCGGGCAATTGCTATGAGGTGCTGACTCGAGTCAGCACCTCATAGCAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-415s1c1
Sequence:CCGGCGAATGGAGGAGAATTTCATACTCGAGTATGAAATTCTCCTCCATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-475s1c1
Sequence:CCGGGTGTACGACTACTATGTGGAACTCGAGTTCCACATAGTAGTCGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152375
KLHDC7A MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 7A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-2100s1c1
Sequence:CCGGGAGGGATCTTAGATGAGTCTTCTCGAGAAGACTCATCTAAGATCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-486s1c1
Sequence:CCGGCTATGTGGAATCTACCTCTCACTCGAGTGAGAGGTAGATTCCACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1131s1c1
Sequence:CCGGCCTCTGTTGCTATGACGATGACTCGAGTCATCGTCATAGCAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-971s1c1
Sequence:CCGGCCTACAAGGTGATGAGCGAAACTCGAGTTTCGCTCATCACCTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-1211s1c1
Sequence:CCGGCCATCTGCAGTCTCTTCAATTCTCGAGAATTGAAGAGACTGCAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-426s1c1
Sequence:CCGGGAATTTCATACAGAAGGCGGACTCGAGTCCGCCTTCTGTATGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-908s1c1
Sequence:CCGGGCAATTGCTATGAGGTGCTGACTCGAGTCAGCACCTCATAGCAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-415s1c1
Sequence:CCGGCGAATGGAGGAGAATTTCATACTCGAGTATGAAATTCTCCTCCATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152375.1-475s1c1
Sequence:CCGGGTGTACGACTACTATGTGGAACTCGAGTTCCACATAGTAGTCGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)