EMAIL THIS PAGE TO A FRIEND

KLHDC7B

kelch domain containing 7B

50 Gene Product Result for
UniProtKB ID: Q96G42
Gene ID:
Mouse(546648) kelch domain containing 7B
Rat(300150) kelch domain containing 7B
cow(539100) kelch domain containing 7B
domestic cat(101082673) kelch domain containing 7B
dog(481185) kelch domain containing 7B
domestic guinea pig(100718534) kelch domain containing 7B
naked mole-rat(101725773) kelch domain containing 7B
sheep(101118522) kelch domain containing 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001160178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001160178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001160178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144581 MISSION® esiRNA esiRNA human KLHDC7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138433 Rosetta Predictions human pricing
XM_001055129 Rosetta Predictions rat pricing
XM_235563 Rosetta Predictions rat pricing
XM_621414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031788 predicted 1263
2 SASI_Hs01_00031789 predicted 1243
3 SASI_Hs01_00031790 predicted 864
4 SASI_Hs01_00031791 predicted 1389
5 SASI_Hs02_00363588 predicted 1651
6 SASI_Hs01_00031792 predicted 1242
7 SASI_Hs01_00031793 predicted 1262
8 SASI_Hs01_00031794 predicted 786
9 SASI_Hs01_00031795 predicted 1545
10 SASI_Hs01_00031796 predicted 1075
11 SASI_Hs01_00031797 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278533 predicted 2127
2 SASI_Rn02_00278534 predicted 1123
3 SASI_Rn02_00278535 predicted 2140
4 SASI_Rn02_00278536 predicted 2403
5 SASI_Rn02_00278537 predicted 1277
6 SASI_Rn02_00278538 predicted 2270
7 SASI_Rn02_00278539 predicted 2063
8 SASI_Rn02_00278540 predicted 1984
9 SASI_Rn02_00278541 predicted 2413
10 SASI_Rn02_00278542 predicted 2227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389469 predicted 2240
2 SASI_Rn02_00389470 predicted 1859
3 SASI_Rn02_00389471 predicted 1123
4 SASI_Rn02_00389472 predicted 2257
5 SASI_Rn02_00389473 predicted 2518
6 SASI_Rn02_00389474 predicted 2388
7 SASI_Rn02_00389475 predicted 2182
8 SASI_Rn02_00389476 predicted 2092
9 SASI_Rn02_00389477 predicted 2525
10 SASI_Rn02_00389478 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427791 predicted 2538
2 SASI_Mm02_00427792 predicted 1616
3 SASI_Mm02_00427793 predicted 2528
4 SASI_Mm02_00427794 predicted 2668
5 SASI_Mm02_00427795 predicted 2003
6 SASI_Mm02_00427796 predicted 2460
7 SASI_Mm02_00427797 predicted 2619
8 SASI_Mm02_00427798 predicted 331
9 SASI_Mm02_00427799 predicted 1484
10 SASI_Mm02_00427800 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138433
KLHDC7B MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 7B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1740s21c1
Sequence:CCGGACCCTGGGCAACACCATTTACCTCGAGGTAAATGGTGTTGCCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1354s21c1
Sequence:CCGGTCTATGCCATCGGTGGCGAATCTCGAGATTCGCCACCGATGGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1267s21c1
Sequence:CCGGACAACCCTCTGACCAACATCTCTCGAGAGATGTTGGTCAGAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1748s1c1
Sequence:CCGGCAACACCATTTACTGCCTCAACTCGAGTTGAGGCAGTAAATGGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1747s1c1
Sequence:CCGGGCAACACCATTTACTGCCTCACTCGAGTGAGGCAGTAAATGGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-527s21c1
Sequence:CCGGGAAACGCAGCAGGTGCGAAATCTCGAGATTTCGCACCTGCTGCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138433.3-2057s21c1
Sequence:CCGGCTTTAAAGGTTGTCGATTATTCTCGAGAATAATCGACAACCTTTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138433
KLHDC7B MISSION shRNA shRNA Plasmid DNA
kelch domain containing 7B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1740s21c1
Sequence:CCGGACCCTGGGCAACACCATTTACCTCGAGGTAAATGGTGTTGCCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1354s21c1
Sequence:CCGGTCTATGCCATCGGTGGCGAATCTCGAGATTCGCCACCGATGGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1267s21c1
Sequence:CCGGACAACCCTCTGACCAACATCTCTCGAGAGATGTTGGTCAGAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1748s1c1
Sequence:CCGGCAACACCATTTACTGCCTCAACTCGAGTTGAGGCAGTAAATGGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1747s1c1
Sequence:CCGGGCAACACCATTTACTGCCTCACTCGAGTGAGGCAGTAAATGGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-527s21c1
Sequence:CCGGGAAACGCAGCAGGTGCGAAATCTCGAGATTTCGCACCTGCTGCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138433.3-2057s21c1
Sequence:CCGGCTTTAAAGGTTGTCGATTATTCTCGAGAATAATCGACAACCTTTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138433
KLHDC7B MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 7B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1740s21c1
Sequence:CCGGACCCTGGGCAACACCATTTACCTCGAGGTAAATGGTGTTGCCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1354s21c1
Sequence:CCGGTCTATGCCATCGGTGGCGAATCTCGAGATTCGCCACCGATGGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-1267s21c1
Sequence:CCGGACAACCCTCTGACCAACATCTCTCGAGAGATGTTGGTCAGAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1748s1c1
Sequence:CCGGCAACACCATTTACTGCCTCAACTCGAGTTGAGGCAGTAAATGGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138433.2-1747s1c1
Sequence:CCGGGCAACACCATTTACTGCCTCACTCGAGTGAGGCAGTAAATGGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138433.3-527s21c1
Sequence:CCGGGAAACGCAGCAGGTGCGAAATCTCGAGATTTCGCACCTGCTGCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138433.3-2057s21c1
Sequence:CCGGCTTTAAAGGTTGTCGATTATTCTCGAGAATAATCGACAACCTTTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160178
KLHDC7B MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-889s21c1
Sequence:CCGGCTCGTGCTACCCAGCCTTTATCTCGAGATAAAGGCTGGGTAGCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1166s21c1
Sequence:CCGGACAACCCTCTGACCAATATTTCTCGAGAAATATTGGTCAGAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-95s21c1
Sequence:CCGGCCACATACTCTGAAGATATACCTCGAGGTATATCTTCAGAGTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1638s21c1
Sequence:CCGGGGTATTGGGCAACACCATTTACTCGAGTAAATGGTGTTGCCCAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1079s21c1
Sequence:CCGGTCTGCACTATGCATAACTATCCTCGAGGATAGTTATGCATAGTGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160178
KLHDC7B MISSION shRNA shRNA Plasmid DNA
kelch domain containing 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-889s21c1
Sequence:CCGGCTCGTGCTACCCAGCCTTTATCTCGAGATAAAGGCTGGGTAGCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1166s21c1
Sequence:CCGGACAACCCTCTGACCAATATTTCTCGAGAAATATTGGTCAGAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-95s21c1
Sequence:CCGGCCACATACTCTGAAGATATACCTCGAGGTATATCTTCAGAGTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1638s21c1
Sequence:CCGGGGTATTGGGCAACACCATTTACTCGAGTAAATGGTGTTGCCCAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1079s21c1
Sequence:CCGGTCTGCACTATGCATAACTATCCTCGAGGATAGTTATGCATAGTGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160178
KLHDC7B MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-889s21c1
Sequence:CCGGCTCGTGCTACCCAGCCTTTATCTCGAGATAAAGGCTGGGTAGCACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1166s21c1
Sequence:CCGGACAACCCTCTGACCAATATTTCTCGAGAAATATTGGTCAGAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-95s21c1
Sequence:CCGGCCACATACTCTGAAGATATACCTCGAGGTATATCTTCAGAGTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1638s21c1
Sequence:CCGGGGTATTGGGCAACACCATTTACTCGAGTAAATGGTGTTGCCCAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160178.1-1079s21c1
Sequence:CCGGTCTGCACTATGCATAACTATCCTCGAGGATAGTTATGCATAGTGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)