EMAIL THIS PAGE TO A FRIEND

KLHDC8B

kelch domain containing 8B

162 Gene Product Result for
UniProtKB ID: Q8IXV7
Gene ID:
Human(200942) Summary: This gene encodes a protein which forms a distinct beta-propeller protein structure of kelch domains allowing for protein-protein interactions. Mutations in this gene have been associated with Hodgkin lymphoma. [provided by RefSeq, Sep 2010]
Mouse(78267) kelch domain containing 8B
Rat(306589) kelch domain containing 8B
chicken(416054) kelch domain containing 8B
domestic cat(101082552) kelch domain containing 8B
cow(527321) kelch domain containing 8B
Horse(100063040) kelch domain containing 8B
dog(484771) kelch domain containing 8B
domestic guinea pig(100732695) kelch domain containing 8B
naked mole-rat(101707489) kelch domain containing 8B
sheep(101106208) kelch domain containing 8B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173546 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075061 MISSION® esiRNA esiRNA human KLHDC8B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173546 Rosetta Predictions human pricing
NM_001007685 Rosetta Predictions rat pricing
XM_001075119 Rosetta Predictions rat pricing
XM_573960 Rosetta Predictions rat pricing
NM_030075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125434 predicted 815
2 SASI_Hs01_00125435 predicted 332
3 SASI_Hs01_00125436 predicted 984
4 SASI_Hs01_00125437 predicted 941
5 SASI_Hs01_00125438 predicted 553
6 SASI_Hs01_00125439 predicted 901
7 SASI_Hs01_00125440 predicted 202
8 SASI_Hs01_00125441 predicted 550
9 SASI_Hs01_00125442 predicted 1275
10 SASI_Hs01_00125443 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090614 predicted 611
2 SASI_Rn01_00090615 predicted 1486
3 SASI_Rn01_00090616 predicted 1536
4 SASI_Rn01_00090617 predicted 1187
5 SASI_Rn01_00090618 predicted 262
6 SASI_Rn02_00198829 predicted 997
7 SASI_Rn01_00090620 predicted 669
8 SASI_Rn01_00090621 predicted 1331
9 SASI_Rn01_00090622 predicted 1571
10 SASI_Rn02_00198830 predicted 765
11 SASI_Rn01_00090613 predicted 1269
12 SASI_Rn01_00090619 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348541 predicted 1421
2 SASI_Rn02_00348542 predicted 970
3 SASI_Rn02_00348543 predicted 1820
4 SASI_Rn02_00348544 predicted 1875
5 SASI_Rn02_00348545 predicted 1526
6 SASI_Rn02_00348546 predicted 1364
7 SASI_Rn02_00348547 predicted 621
8 SASI_Rn02_00348548 predicted 1023
9 SASI_Rn02_00348549 predicted 1671
10 SASI_Rn02_00348550 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188053 predicted 1275
2 SASI_Rn01_00188054 predicted 1268
3 SASI_Rn01_00188055 predicted 1486
4 SASI_Rn01_00188056 predicted 1536
5 SASI_Rn01_00188057 predicted 1195
6 SASI_Rn01_00188058 predicted 1305
7 SASI_Rn01_00188059 predicted 1432
8 SASI_Rn01_00188060 predicted 1333
9 SASI_Rn01_00188061 predicted 1467
10 SASI_Rn01_00188062 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056046 predicted 2599
2 SASI_Mm01_00056047 predicted 1385
3 SASI_Mm01_00056048 predicted 2537
4 SASI_Mm01_00056049 predicted 2524
5 SASI_Mm01_00056050 predicted 1292
6 SASI_Mm01_00056051 predicted 2032
7 SASI_Mm01_00056053 predicted 2254
8 SASI_Mm01_00056054 predicted 1250
9 SASI_Mm01_00056055 predicted 1281
10 SASI_Mm02_00336468 predicted 1733
11 SASI_Mm01_00056052 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030075
KLHDC8B MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 8B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2725s1c1
Sequence:CCGGCAGAAGAAACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1962s1c1
Sequence:CCGGGCACTTTGTCAACACTGTGGACTCGAGTCCACAGTGTTGACAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2453s1c1
Sequence:CCGGGCCTTTGTCTTTAGCATAGGACTCGAGTCCTATGCTAAAGACAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2531s1c1
Sequence:CCGGCCTATGCCCTAGAAGTTACTACTCGAGTAGTAACTTCTAGGGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2329s1c2
Sequence:CCGGCAGCTCACTATAGAAGCAGATCTCGAGATCTGCTTCTATAGTGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2702s1c1
Sequence:CCGGGAGTATTCTGAGGATGGAAATCTCGAGATTTCCATCCTCAGAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1606s1c1
Sequence:CCGGGAGAGAGATGGTATGGTGTATCTCGAGATACACCATACCATCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030075
KLHDC8B MISSION shRNA shRNA Plasmid DNA
kelch domain containing 8B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2725s1c1
Sequence:CCGGCAGAAGAAACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1962s1c1
Sequence:CCGGGCACTTTGTCAACACTGTGGACTCGAGTCCACAGTGTTGACAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2453s1c1
Sequence:CCGGGCCTTTGTCTTTAGCATAGGACTCGAGTCCTATGCTAAAGACAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2531s1c1
Sequence:CCGGCCTATGCCCTAGAAGTTACTACTCGAGTAGTAACTTCTAGGGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2329s1c2
Sequence:CCGGCAGCTCACTATAGAAGCAGATCTCGAGATCTGCTTCTATAGTGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2702s1c1
Sequence:CCGGGAGTATTCTGAGGATGGAAATCTCGAGATTTCCATCCTCAGAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1606s1c1
Sequence:CCGGGAGAGAGATGGTATGGTGTATCTCGAGATACACCATACCATCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030075
KLHDC8B MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 8B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2725s1c1
Sequence:CCGGCAGAAGAAACAAAGGAGAGAACTCGAGTTCTCTCCTTTGTTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1962s1c1
Sequence:CCGGGCACTTTGTCAACACTGTGGACTCGAGTCCACAGTGTTGACAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2453s1c1
Sequence:CCGGGCCTTTGTCTTTAGCATAGGACTCGAGTCCTATGCTAAAGACAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2531s1c1
Sequence:CCGGCCTATGCCCTAGAAGTTACTACTCGAGTAGTAACTTCTAGGGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2329s1c2
Sequence:CCGGCAGCTCACTATAGAAGCAGATCTCGAGATCTGCTTCTATAGTGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030075.1-2702s1c1
Sequence:CCGGGAGTATTCTGAGGATGGAAATCTCGAGATTTCCATCCTCAGAATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030075.1-1606s1c1
Sequence:CCGGGAGAGAGATGGTATGGTGTATCTCGAGATACACCATACCATCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173546
VALIDATED
KLHDC8B MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 8B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-918s1c1
Sequence:CCGGGTCAACACTGTGGAGATGTTTCTCGAGAAACATCTCCACAGTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-1284s21c1
Sequence:CCGGATTGCCAGAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTCTGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-556s21c1
Sequence:CCGGAGAGAGATGGTATGGTGTATGCTCGAGCATACACCATACCATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-841s21c1
Sequence:CCGGTGGCTGAAGGCAGCGTCTTTACTCGAGTAAAGACGCTGCCTTCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-700s21c1
Sequence:CCGGTGCACGGGAACAAGATCTATGCTCGAGCATAGATCTTGTTCCCGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-914s1c1
Sequence:CCGGCTTTGTCAACACTGTGGAGATCTCGAGATCTCCACAGTGTTGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-898s21c1
Sequence:CCGGTCTACTCTCGCCCACACTTTGCTCGAGCAAAGTGTGGGCGAGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173546
VALIDATED
KLHDC8B MISSION shRNA shRNA Plasmid DNA
kelch domain containing 8B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-918s1c1
Sequence:CCGGGTCAACACTGTGGAGATGTTTCTCGAGAAACATCTCCACAGTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-1284s21c1
Sequence:CCGGATTGCCAGAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTCTGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-556s21c1
Sequence:CCGGAGAGAGATGGTATGGTGTATGCTCGAGCATACACCATACCATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-841s21c1
Sequence:CCGGTGGCTGAAGGCAGCGTCTTTACTCGAGTAAAGACGCTGCCTTCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-700s21c1
Sequence:CCGGTGCACGGGAACAAGATCTATGCTCGAGCATAGATCTTGTTCCCGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-914s1c1
Sequence:CCGGCTTTGTCAACACTGTGGAGATCTCGAGATCTCCACAGTGTTGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-898s21c1
Sequence:CCGGTCTACTCTCGCCCACACTTTGCTCGAGCAAAGTGTGGGCGAGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173546
VALIDATED
KLHDC8B MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 8B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-918s1c1
Sequence:CCGGGTCAACACTGTGGAGATGTTTCTCGAGAAACATCTCCACAGTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-1284s21c1
Sequence:CCGGATTGCCAGAGGCAGCTATTTCCTCGAGGAAATAGCTGCCTCTGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173546.1-556s21c1
Sequence:CCGGAGAGAGATGGTATGGTGTATGCTCGAGCATACACCATACCATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-841s21c1
Sequence:CCGGTGGCTGAAGGCAGCGTCTTTACTCGAGTAAAGACGCTGCCTTCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-700s21c1
Sequence:CCGGTGCACGGGAACAAGATCTATGCTCGAGCATAGATCTTGTTCCCGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173546.1-914s1c1
Sequence:CCGGCTTTGTCAACACTGTGGAGATCTCGAGATCTCCACAGTGTTGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173546.1-898s21c1
Sequence:CCGGTCTACTCTCGCCCACACTTTGCTCGAGCAAAGTGTGGGCGAGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)