EMAIL THIS PAGE TO A FRIEND

KLHDC9

kelch domain containing 9

93 Gene Product Result for
Synonyms: KARCA1
UniProtKB ID: Q8NEP7, Q5SY56, Q6NXT9, Q6PKN4, Q8N5E1, Q8NA16
Gene ID:
Mouse(68874) kelch domain containing 9
Rat(360878) kelch domain containing 9
sheep(101101852) kelch domain containing 9
domestic guinea pig(100727295) kelch domain containing 9
naked mole-rat(101707645) kelch domain containing 9
dog(478976) kelch domain containing 9
cow(526819) kelch domain containing 9
domestic cat(101088546) kelch domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152366 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216861 MISSION® esiRNA esiRNA targeting mouse Klhdc9 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007255 Rosetta Predictions human pricing
NM_001007256 Rosetta Predictions human pricing
NM_152366 Rosetta Predictions human pricing
NM_001108350 Rosetta Predictions rat pricing
NM_001033039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160323 predicted 1135
2 SASI_Hs01_00160325 predicted 1104
3 SASI_Hs01_00160326 predicted 1113
4 SASI_Hs01_00160327 predicted 1131
5 SASI_Hs01_00160328 predicted 619
6 SASI_Hs01_00160329 predicted 553
7 SASI_Hs01_00160330 predicted 1079
8 SASI_Hs01_00160331 predicted 1129
9 SASI_Hs01_00160332 predicted 561
10 SASI_Hs02_00305281 predicted 617
11 SASI_Hs01_00160324 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093939 predicted 855
2 SASI_Hs01_00093940 predicted 827
3 SASI_Hs01_00093941 predicted 839
4 SASI_Hs01_00093942 predicted 850
5 SASI_Hs01_00093943 predicted 804
6 SASI_Hs01_00093944 predicted 847
7 SASI_Hs01_00093945 predicted 801
8 SASI_Hs01_00093946 predicted 795
9 SASI_Hs01_00093947 predicted 796
10 SASI_Hs01_00093948 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156397 predicted 1116
2 SASI_Hs01_00156399 predicted 1086
3 SASI_Hs01_00156400 predicted 1101
4 SASI_Hs01_00156401 predicted 1117
5 SASI_Hs01_00156402 predicted 611
6 SASI_Hs01_00156403 predicted 556
7 SASI_Hs01_00156404 predicted 1066
8 SASI_Hs01_00156405 predicted 1116
9 SASI_Hs01_00156406 predicted 562
10 SASI_Hs02_00366014 predicted 618
11 SASI_Hs01_00156398 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237799 predicted 1248
2 SASI_Rn02_00237800 predicted 1361
3 SASI_Rn02_00237801 predicted 256
4 SASI_Rn02_00237802 predicted 708
5 SASI_Rn02_00237803 predicted 237
6 SASI_Rn02_00237804 predicted 862
7 SASI_Rn02_00237805 predicted 1075
8 SASI_Rn02_00237806 predicted 744
9 SASI_Rn02_00237807 predicted 651
10 SASI_Rn02_00237808 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024116 predicted 614
2 SASI_Mm02_00288173 predicted 644
3 SASI_Mm01_00024117 predicted 1076
4 SASI_Mm01_00024118 predicted 1209
5 SASI_Mm01_00024119 predicted 601
6 SASI_Mm01_00024120 predicted 935
7 SASI_Mm01_00024121 predicted 944
8 SASI_Mm01_00024122 predicted 1244
9 SASI_Mm01_00024123 predicted 906
10 SASI_Mm01_00024124 predicted 649
11 SASI_Mm01_00024125 predicted 959
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033039
KLHDC9 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033039.2-1328s21c1
Sequence:CCGGACTTATATAAGTGCCCTATTTCTCGAGAAATAGGGCACTTATATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-642s21c1
Sequence:CCGGGACCACAGGACCCGAACTTATCTCGAGATAAGTTCGGGTCCTGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-616s21c1
Sequence:CCGGACGGAAGCATCTACACGTTAACTCGAGTTAACGTGTAGATGCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-939s21c1
Sequence:CCGGGGACCCTTCGCTGTACTATTTCTCGAGAAATAGTACAGCGAAGGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-301s21c1
Sequence:CCGGGCAACGACACTGTGATCTTTGCTCGAGCAAAGATCACAGTGTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033039
KLHDC9 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033039.2-1328s21c1
Sequence:CCGGACTTATATAAGTGCCCTATTTCTCGAGAAATAGGGCACTTATATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-642s21c1
Sequence:CCGGGACCACAGGACCCGAACTTATCTCGAGATAAGTTCGGGTCCTGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-616s21c1
Sequence:CCGGACGGAAGCATCTACACGTTAACTCGAGTTAACGTGTAGATGCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-939s21c1
Sequence:CCGGGGACCCTTCGCTGTACTATTTCTCGAGAAATAGTACAGCGAAGGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-301s21c1
Sequence:CCGGGCAACGACACTGTGATCTTTGCTCGAGCAAAGATCACAGTGTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033039
KLHDC9 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033039.2-1328s21c1
Sequence:CCGGACTTATATAAGTGCCCTATTTCTCGAGAAATAGGGCACTTATATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-642s21c1
Sequence:CCGGGACCACAGGACCCGAACTTATCTCGAGATAAGTTCGGGTCCTGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-616s21c1
Sequence:CCGGACGGAAGCATCTACACGTTAACTCGAGTTAACGTGTAGATGCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-939s21c1
Sequence:CCGGGGACCCTTCGCTGTACTATTTCTCGAGAAATAGTACAGCGAAGGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033039.2-301s21c1
Sequence:CCGGGCAACGACACTGTGATCTTTGCTCGAGCAAAGATCACAGTGTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152366
KLHDC9 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-773s21c1
Sequence:CCGGCATCCAGGTCATCAGCTATTGCTCGAGCAATAGCTGATGACCTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-795s21c1
Sequence:CCGGTCTTTGGAGGTTGCAACTTAGCTCGAGCTAAGTTGCAACCTCCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-1032s21c1
Sequence:GTACCGGGCAATGATCTCTACATCTATGCTCGAGCATAGATGTAGAGATCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-650s21c1
Sequence:CCGGTATGGAAGCATCTACACATTACTCGAGTAATGTGTAGATGCTTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-851s1c1
Sequence:CCGGCCCTCCCTCTTATCCCACCTACTCGAGTAGGTGGGATAAGAGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-865s21c1
Sequence:CCGGACCACCTGTTGCTCCTCATTTCTCGAGAAATGAGGAGCAACAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-755s1c1
Sequence:CCGGCAGATTTCTCAGGCAATTTATCTCGAGATAAATTGCCTGAGAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-830s1c1
Sequence:CCGGGCTGAGCTCTCTACAGTATTACTCGAGTAATACTGTAGAGAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-640s1c1
Sequence:CCGGCTATGGAAGCATCTACACATTCTCGAGAATGTGTAGATGCTTCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-324s1c1
Sequence:CCGGCCAGCAGCGATACGGTGGTTTCTCGAGAAACCACCGTATCGCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152366
KLHDC9 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-773s21c1
Sequence:CCGGCATCCAGGTCATCAGCTATTGCTCGAGCAATAGCTGATGACCTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-795s21c1
Sequence:CCGGTCTTTGGAGGTTGCAACTTAGCTCGAGCTAAGTTGCAACCTCCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-1032s21c1
Sequence:GTACCGGGCAATGATCTCTACATCTATGCTCGAGCATAGATGTAGAGATCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-650s21c1
Sequence:CCGGTATGGAAGCATCTACACATTACTCGAGTAATGTGTAGATGCTTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-851s1c1
Sequence:CCGGCCCTCCCTCTTATCCCACCTACTCGAGTAGGTGGGATAAGAGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-865s21c1
Sequence:CCGGACCACCTGTTGCTCCTCATTTCTCGAGAAATGAGGAGCAACAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-755s1c1
Sequence:CCGGCAGATTTCTCAGGCAATTTATCTCGAGATAAATTGCCTGAGAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-830s1c1
Sequence:CCGGGCTGAGCTCTCTACAGTATTACTCGAGTAATACTGTAGAGAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-640s1c1
Sequence:CCGGCTATGGAAGCATCTACACATTCTCGAGAATGTGTAGATGCTTCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-324s1c1
Sequence:CCGGCCAGCAGCGATACGGTGGTTTCTCGAGAAACCACCGTATCGCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152366
KLHDC9 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-773s21c1
Sequence:CCGGCATCCAGGTCATCAGCTATTGCTCGAGCAATAGCTGATGACCTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-795s21c1
Sequence:CCGGTCTTTGGAGGTTGCAACTTAGCTCGAGCTAAGTTGCAACCTCCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-1032s21c1
Sequence:GTACCGGGCAATGATCTCTACATCTATGCTCGAGCATAGATGTAGAGATCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-650s21c1
Sequence:CCGGTATGGAAGCATCTACACATTACTCGAGTAATGTGTAGATGCTTCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-851s1c1
Sequence:CCGGCCCTCCCTCTTATCCCACCTACTCGAGTAGGTGGGATAAGAGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152366.3-865s21c1
Sequence:CCGGACCACCTGTTGCTCCTCATTTCTCGAGAAATGAGGAGCAACAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-755s1c1
Sequence:CCGGCAGATTTCTCAGGCAATTTATCTCGAGATAAATTGCCTGAGAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-830s1c1
Sequence:CCGGGCTGAGCTCTCTACAGTATTACTCGAGTAATACTGTAGAGAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-640s1c1
Sequence:CCGGCTATGGAAGCATCTACACATTCTCGAGAATGTGTAGATGCTTCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152366.2-324s1c1
Sequence:CCGGCCAGCAGCGATACGGTGGTTTCTCGAGAAACCACCGTATCGCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)