EMAIL THIS PAGE TO A FRIEND

KLHL10

kelch-like family member 10

62 Gene Product Result for
Synonyms: SPGF11
UniProtKB ID: Q6JEL2, Q6NW28, Q96MC0
Gene ID:
Mouse(66720) kelch-like 10
Rat(303533) kelch-like family member 10
sheep(101119736) kelch-like 10 (Drosophila)
domestic guinea pig(100714380) kelch-like family member 10
naked mole-rat(101703895) kelch-like family member 10
fruit fly(3354863) CG12423 gene product from transcript CG12423-RB
cow(541263) kelch-like 10 (Drosophila)
domestic cat(101092562) kelch-like 10 (Drosophila)
dog(480521) kelch-like 10 (Drosophila)
chicken(420033) kelch-like 10 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152467 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040031 MISSION® esiRNA esiRNA human KLHL10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152467 Rosetta Predictions human pricing
NM_001001510 Rosetta Predictions rat pricing
XM_579054 Rosetta Predictions rat pricing
NM_025727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366242 predicted 382
2 SASI_Hs01_00135657 predicted 1489
3 SASI_Hs01_00135658 predicted 1554
4 SASI_Hs01_00135659 predicted 1492
5 SASI_Hs01_00135660 predicted 1067
6 SASI_Hs01_00135661 predicted 326
7 SASI_Hs01_00135662 predicted 1555
8 SASI_Hs01_00135663 predicted 741
9 SASI_Hs02_00366243 predicted 1594
10 SASI_Hs02_00366244 predicted 486
11 SASI_Hs01_00135654 predicted 367
12 SASI_Hs01_00135655 predicted 1485
13 SASI_Hs01_00135656 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039537 predicted 1780
2 SASI_Rn01_00039539 predicted 1438
3 SASI_Rn01_00039540 predicted 1410
4 SASI_Rn01_00039541 predicted 865
5 SASI_Rn01_00039542 predicted 246
6 SASI_Rn01_00039543 predicted 1610
7 SASI_Rn01_00039544 predicted 701
8 SASI_Rn02_00197910 predicted 799
9 SASI_Rn01_00039545 predicted 889
10 SASI_Rn01_00039546 predicted 238
11 SASI_Rn01_00039538 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00168882 predicted 252
2 SASI_Rn01_00168883 predicted 329
3 SASI_Rn01_00168884 predicted 224
4 SASI_Rn01_00168885 predicted 254
5 SASI_Rn01_00168886 predicted 285
6 SASI_Rn01_00168887 predicted 250
7 SASI_Rn01_00168888 predicted 239
8 SASI_Rn01_00168889 predicted 368
9 SASI_Rn01_00168890 predicted 275
10 SASI_Rn01_00168891 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328908 predicted 617
2 SASI_Mm01_00046617 predicted 359
3 SASI_Mm01_00046618 predicted 867
4 SASI_Mm01_00046619 predicted 1777
5 SASI_Mm01_00046620 predicted 291
6 SASI_Mm01_00046622 predicted 1421
7 SASI_Mm01_00046623 predicted 811
8 SASI_Mm01_00046624 predicted 517
9 SASI_Mm01_00046626 predicted 1459
10 SASI_Mm02_00328909 predicted 756
11 SASI_Mm01_00046621 predicted 937
12 SASI_Mm01_00046625 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025727
KLHL10 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 10
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1156s1c1
Sequence:CCGGGTAGACTACTTCAATAGTGTTCTCGAGAACACTATTGAAGTAGTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.1-1108s1c1
Sequence:CCGGGCAGCCTACTTGAAAGGCTATCTCGAGATAGCCTTTCAAGTAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1640s1c1
Sequence:CCGGCCACTATGTTTAACCCTCGTACTCGAGTACGAGGGTTAAACATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-150s1c1
Sequence:CCGGGCCTCACATGGAAAGAAAGATCTCGAGATCTTTCTTTCCATGTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1476s1c1
Sequence:CCGGGAGCAATCAATGGACAGTCATCTCGAGATGACTGTCCATTGATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-369s1c1
Sequence:CCGGCGACATGATGAAGCTAATTATCTCGAGATAATTAGCTTCATCATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-1776s1c1
Sequence:CCGGGCTCATGACATGAGCATATACCTCGAGGTATATGCTCATGTCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-879s1c1
Sequence:CCGGGTCATCATTAACGCCCTAAAGCTCGAGCTTTAGGGCGTTAATGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025727
KLHL10 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 10
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1156s1c1
Sequence:CCGGGTAGACTACTTCAATAGTGTTCTCGAGAACACTATTGAAGTAGTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.1-1108s1c1
Sequence:CCGGGCAGCCTACTTGAAAGGCTATCTCGAGATAGCCTTTCAAGTAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1640s1c1
Sequence:CCGGCCACTATGTTTAACCCTCGTACTCGAGTACGAGGGTTAAACATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-150s1c1
Sequence:CCGGGCCTCACATGGAAAGAAAGATCTCGAGATCTTTCTTTCCATGTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1476s1c1
Sequence:CCGGGAGCAATCAATGGACAGTCATCTCGAGATGACTGTCCATTGATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-369s1c1
Sequence:CCGGCGACATGATGAAGCTAATTATCTCGAGATAATTAGCTTCATCATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-1776s1c1
Sequence:CCGGGCTCATGACATGAGCATATACCTCGAGGTATATGCTCATGTCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-879s1c1
Sequence:CCGGGTCATCATTAACGCCCTAAAGCTCGAGCTTTAGGGCGTTAATGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025727
KLHL10 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 10
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1156s1c1
Sequence:CCGGGTAGACTACTTCAATAGTGTTCTCGAGAACACTATTGAAGTAGTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.1-1108s1c1
Sequence:CCGGGCAGCCTACTTGAAAGGCTATCTCGAGATAGCCTTTCAAGTAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1640s1c1
Sequence:CCGGCCACTATGTTTAACCCTCGTACTCGAGTACGAGGGTTAAACATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-150s1c1
Sequence:CCGGGCCTCACATGGAAAGAAAGATCTCGAGATCTTTCTTTCCATGTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-1476s1c1
Sequence:CCGGGAGCAATCAATGGACAGTCATCTCGAGATGACTGTCCATTGATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025727.1-369s1c1
Sequence:CCGGCGACATGATGAAGCTAATTATCTCGAGATAATTAGCTTCATCATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-1776s1c1
Sequence:CCGGGCTCATGACATGAGCATATACCTCGAGGTATATGCTCATGTCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025727.3-879s1c1
Sequence:CCGGGTCATCATTAACGCCCTAAAGCTCGAGCTTTAGGGCGTTAATGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152467
KLHL10 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1637s1c1
Sequence:CCGGCCACTATGTTTAATCCTCGTACTCGAGTACGAGGATTAAACATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1454s1c1
Sequence:CCGGCAGAAGTGTATAACACTGAAACTCGAGTTTCAGTGTTATACACTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152467.1-367s1c1
Sequence:CCGGGACATGATGAAGCTAATCATTCTCGAGAATGATTAGCTTCATCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-372s1c1
Sequence:CCGGGATGAAGCTAATCATTGAGTACTCGAGTACTCAATGATTAGCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-814s1c1
Sequence:CCGGGAGTACTTCATGAACAATGTTCTCGAGAACATTGTTCATGAAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-456s1c1
Sequence:CCGGCCAGTTTAACATCATGGGTATCTCGAGATACCCATGATGTTAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1652s21c1
Sequence:CCGGGCTAACACTTGGCGCACAATCCTCGAGGATTGTGCGCCAAGTGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1606s21c1
Sequence:CCGGTGATGGAGCTAATCGACTTAGCTCGAGCTAAGTCGATTAGCTCCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152467
KLHL10 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1637s1c1
Sequence:CCGGCCACTATGTTTAATCCTCGTACTCGAGTACGAGGATTAAACATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1454s1c1
Sequence:CCGGCAGAAGTGTATAACACTGAAACTCGAGTTTCAGTGTTATACACTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152467.1-367s1c1
Sequence:CCGGGACATGATGAAGCTAATCATTCTCGAGAATGATTAGCTTCATCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-372s1c1
Sequence:CCGGGATGAAGCTAATCATTGAGTACTCGAGTACTCAATGATTAGCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-814s1c1
Sequence:CCGGGAGTACTTCATGAACAATGTTCTCGAGAACATTGTTCATGAAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-456s1c1
Sequence:CCGGCCAGTTTAACATCATGGGTATCTCGAGATACCCATGATGTTAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1652s21c1
Sequence:CCGGGCTAACACTTGGCGCACAATCCTCGAGGATTGTGCGCCAAGTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1606s21c1
Sequence:CCGGTGATGGAGCTAATCGACTTAGCTCGAGCTAAGTCGATTAGCTCCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152467
KLHL10 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1637s1c1
Sequence:CCGGCCACTATGTTTAATCCTCGTACTCGAGTACGAGGATTAAACATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-1454s1c1
Sequence:CCGGCAGAAGTGTATAACACTGAAACTCGAGTTTCAGTGTTATACACTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152467.1-367s1c1
Sequence:CCGGGACATGATGAAGCTAATCATTCTCGAGAATGATTAGCTTCATCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-372s1c1
Sequence:CCGGGATGAAGCTAATCATTGAGTACTCGAGTACTCAATGATTAGCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-814s1c1
Sequence:CCGGGAGTACTTCATGAACAATGTTCTCGAGAACATTGTTCATGAAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152467.1-456s1c1
Sequence:CCGGCCAGTTTAACATCATGGGTATCTCGAGATACCCATGATGTTAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1652s21c1
Sequence:CCGGGCTAACACTTGGCGCACAATCCTCGAGGATTGTGCGCCAAGTGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152467.3-1606s21c1
Sequence:CCGGTGATGGAGCTAATCGACTTAGCTCGAGCTAAGTCGATTAGCTCCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)