EMAIL THIS PAGE TO A FRIEND

KLHL11

kelch-like family member 11

56 Gene Product Result for
UniProtKB ID: Q9NVR0
Gene ID:
Mouse(217194) kelch-like 11
Rat(287706) kelch-like family member 11
Zebrafish(327313) kelch-like 11 (Drosophila)
cow(538695) kelch-like 11 (Drosophila)
domestic cat(101089662) kelch-like 11 (Drosophila)
dog(480520) kelch-like 11 (Drosophila)
chicken(428313) kelch-like 11 (Drosophila)
domestic guinea pig(100714656) kelch-like family member 11
naked mole-rat(101703426) kelch-like family member 11
sheep(101120177) kelch-like 11 (Drosophila)
Domestic Rabbit(100342151) kelch-like 11 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018143 Rosetta Predictions human pricing
NM_001105838 Rosetta Predictions rat pricing
NM_172565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018324 predicted 1385
2 SASI_Hs02_00351374 predicted 1359
3 SASI_Hs01_00018326 predicted 1221
4 SASI_Hs01_00018327 predicted 546
5 SASI_Hs01_00018328 predicted 1462
6 SASI_Hs01_00018329 predicted 1703
7 SASI_Hs01_00018330 predicted 733
8 SASI_Hs01_00018331 predicted 1615
9 SASI_Hs01_00018332 predicted 935
10 SASI_Hs02_00351375 predicted 1344
11 SASI_Hs01_00018325 predicted 1131
12 SASI_Hs01_00018333 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213022 predicted 1257
2 SASI_Rn02_00213023 predicted 832
3 SASI_Rn02_00213024 predicted 1676
4 SASI_Rn02_00213025 predicted 1482
5 SASI_Rn02_00213026 predicted 671
6 SASI_Rn02_00213027 predicted 1076
7 SASI_Rn02_00213028 predicted 2186
8 SASI_Rn02_00213029 predicted 1660
9 SASI_Rn02_00213030 predicted 1748
10 SASI_Rn02_00213031 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163971 predicted 1171
2 SASI_Mm01_00163972 predicted 669
3 SASI_Mm01_00163973 predicted 291
4 SASI_Mm01_00163974 predicted 1516
5 SASI_Mm01_00163975 predicted 424
6 SASI_Mm01_00163976 predicted 1130
7 SASI_Mm01_00163977 predicted 1678
8 SASI_Mm02_00344218 predicted 1482
9 SASI_Mm01_00163979 predicted 953
10 SASI_Mm01_00163980 predicted 993
11 SASI_Mm01_00163978 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172565
VALIDATED
KLHL11 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-2284s21c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1250s21c1
Sequence:CCGGATGGACATGCCGTCGCAATTACTCGAGTAATTGCGACGGCATGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1864s21c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1428s21c1
Sequence:CCGGCATTGGAGGACACGGCAATTTCTCGAGAAATTGCCGTGTCCTCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1753s21c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-592s1c1
Sequence:CCGGGCTGGCCGACAGATTCTTATTCTCGAGAATAAGAATCTGTCGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1865s1c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-2285s1c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1489s1c1
Sequence:CCGGGCTTGATAAATGGCACAACTTCTCGAGAAGTTGTGCCATTTATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1754s1c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-731s1c1
Sequence:CCGGGCAGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172565
VALIDATED
KLHL11 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-2284s21c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1250s21c1
Sequence:CCGGATGGACATGCCGTCGCAATTACTCGAGTAATTGCGACGGCATGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1864s21c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1428s21c1
Sequence:CCGGCATTGGAGGACACGGCAATTTCTCGAGAAATTGCCGTGTCCTCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1753s21c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-592s1c1
Sequence:CCGGGCTGGCCGACAGATTCTTATTCTCGAGAATAAGAATCTGTCGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1865s1c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-2285s1c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1489s1c1
Sequence:CCGGGCTTGATAAATGGCACAACTTCTCGAGAAGTTGTGCCATTTATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1754s1c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-731s1c1
Sequence:CCGGGCAGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172565
VALIDATED
KLHL11 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 11
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-2284s21c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1250s21c1
Sequence:CCGGATGGACATGCCGTCGCAATTACTCGAGTAATTGCGACGGCATGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1864s21c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1428s21c1
Sequence:CCGGCATTGGAGGACACGGCAATTTCTCGAGAAATTGCCGTGTCCTCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172565.2-1753s21c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-592s1c1
Sequence:CCGGGCTGGCCGACAGATTCTTATTCTCGAGAATAAGAATCTGTCGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1865s1c1
Sequence:CCGGGCCATTTGCTATTACAGAGATCTCGAGATCTCTGTAATAGCAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-2285s1c1
Sequence:CCGGCTTGGACTTATTACCCTATATCTCGAGATATAGGGTAATAAGTCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1489s1c1
Sequence:CCGGGCTTGATAAATGGCACAACTTCTCGAGAAGTTGTGCCATTTATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172565.1-1754s1c1
Sequence:CCGGCCCAAGAGTTACTCCTTAGAACTCGAGTTCTAAGGAGTAACTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172565.1-731s1c1
Sequence:CCGGGCAGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018143
KLHL11 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1465s1c1
Sequence:CCGGGCACCAAAGATTCTTCGAGATCTCGAGATCTCGAAGAATCTTTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1702s1c1
Sequence:CCGGCCCAAGAGTTATTGTTTAGAACTCGAGTTCTAAACAATAACTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1499s1c1
Sequence:CCGGCCATTGAAGACCGGTTTGTATCTCGAGATACAAACCGGTCTTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1888s1c1
Sequence:CCGGCGGAAAGAAGCCTACCGATATCTCGAGATATCGGTAGGCTTCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018143.1-2168s1c1
Sequence:CCGGCCGTTTCGTGAAGCTGAAGATCTCGAGATCTTCAGCTTCACGAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1786s1c1
Sequence:CCGGCCAGAAGTCCTAAGCATCGAACTCGAGTTCGATGCTTAGGACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-888s1c1
Sequence:CCGGGTCCCAGATGAAACCTACCTACTCGAGTAGGTAGGTTTCATCTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-679s1c1
Sequence:CCGGGCTGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1810s1c1
Sequence:CCGGGCAGCCATTTGCTATTACAAACTCGAGTTTGTAATAGCAAATGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018143
KLHL11 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1465s1c1
Sequence:CCGGGCACCAAAGATTCTTCGAGATCTCGAGATCTCGAAGAATCTTTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1702s1c1
Sequence:CCGGCCCAAGAGTTATTGTTTAGAACTCGAGTTCTAAACAATAACTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1499s1c1
Sequence:CCGGCCATTGAAGACCGGTTTGTATCTCGAGATACAAACCGGTCTTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1888s1c1
Sequence:CCGGCGGAAAGAAGCCTACCGATATCTCGAGATATCGGTAGGCTTCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018143.1-2168s1c1
Sequence:CCGGCCGTTTCGTGAAGCTGAAGATCTCGAGATCTTCAGCTTCACGAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1786s1c1
Sequence:CCGGCCAGAAGTCCTAAGCATCGAACTCGAGTTCGATGCTTAGGACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-888s1c1
Sequence:CCGGGTCCCAGATGAAACCTACCTACTCGAGTAGGTAGGTTTCATCTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-679s1c1
Sequence:CCGGGCTGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1810s1c1
Sequence:CCGGGCAGCCATTTGCTATTACAAACTCGAGTTTGTAATAGCAAATGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018143
KLHL11 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1465s1c1
Sequence:CCGGGCACCAAAGATTCTTCGAGATCTCGAGATCTCGAAGAATCTTTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1702s1c1
Sequence:CCGGCCCAAGAGTTATTGTTTAGAACTCGAGTTCTAAACAATAACTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1499s1c1
Sequence:CCGGCCATTGAAGACCGGTTTGTATCTCGAGATACAAACCGGTCTTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1888s1c1
Sequence:CCGGCGGAAAGAAGCCTACCGATATCTCGAGATATCGGTAGGCTTCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018143.1-2168s1c1
Sequence:CCGGCCGTTTCGTGAAGCTGAAGATCTCGAGATCTTCAGCTTCACGAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-1786s1c1
Sequence:CCGGCCAGAAGTCCTAAGCATCGAACTCGAGTTCGATGCTTAGGACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018143.1-888s1c1
Sequence:CCGGGTCCCAGATGAAACCTACCTACTCGAGTAGGTAGGTTTCATCTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-679s1c1
Sequence:CCGGGCTGATATGATACGGAGAAATCTCGAGATTTCTCCGTATCATATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018143.1-1810s1c1
Sequence:CCGGGCAGCCATTTGCTATTACAAACTCGAGTTTGTAATAGCAAATGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)