EMAIL THIS PAGE TO A FRIEND

KLHL12

kelch-like family member 12

136 Gene Product Result for
Synonyms: C3IP1 DKIR hDKIR
UniProtKB ID: Q53G59, A6NEN8, B7Z7B8, Q9HBX5
Gene ID:
Mouse(240756) kelch-like 12
Rat(266772) kelch-like family member 12
sheep(101104167) kelch-like 12 (Drosophila)
Domestic Rabbit(100355315) kelch-like 12 (Drosophila)
domestic guinea pig(100729002) kelch-like family member 12
naked mole-rat(101710039) kelch-like family member 12
Zebrafish(492362) kelch-like 12 (Drosophila)
chicken(421171) kelch-like 12 (Drosophila)
cow(768068) kelch-like 12 (Drosophila)
Horse(100052378) kelch-like 12 (Drosophila)
domestic cat(101099522) kelch-like 12 (Drosophila)
dog(479996) kelch-like 12 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021633 Rosetta Predictions human pricing
NM_153730 Rosetta Predictions rat pricing
NM_153128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354984 predicted 1760
2 SASI_Hs02_00354985 predicted 1978
3 SASI_Hs02_00354986 predicted 1548
4 SASI_Hs02_00354987 predicted 1485
5 SASI_Hs02_00354988 predicted 1154
6 SASI_Hs02_00354989 predicted 1543
7 SASI_Hs01_00188803 predicted 910
8 SASI_Hs02_00354990 predicted 783
9 SASI_Hs02_00354991 predicted 1993
10 SASI_Hs02_00354992 predicted 1536
11 SASI_Hs01_00188801 predicted 821
12 SASI_Hs01_00188802 predicted 385
13 SASI_Hs01_00188804 predicted 305
14 SASI_Hs01_00188805 predicted 1780
15 SASI_Hs01_00188806 predicted 1686
16 SASI_Hs01_00188807 predicted 1783
17 SASI_Hs01_00188808 predicted 241
18 SASI_Hs01_00188809 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098638 predicted 1218
2 SASI_Rn01_00098639 predicted 1301
3 SASI_Rn01_00098640 predicted 1356
4 SASI_Rn01_00098641 predicted 548
5 SASI_Rn01_00098642 predicted 433
6 SASI_Rn01_00098643 predicted 1580
7 SASI_Rn02_00269024 predicted 1035
8 SASI_Rn01_00098644 predicted 882
9 SASI_Rn01_00098645 predicted 936
10 SASI_Rn01_00098646 predicted 1130
11 SASI_Rn01_00098647 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190855 predicted 844
2 SASI_Mm01_00190856 predicted 733
3 SASI_Mm01_00190857 predicted 690
4 SASI_Mm01_00190860 predicted 1406
5 SASI_Mm01_00190858 predicted 1034
6 SASI_Mm02_00342998 predicted 1423
7 SASI_Mm02_00342999 predicted 1491
8 SASI_Mm01_00190861 predicted 1646
9 SASI_Mm02_00343000 predicted 378
10 SASI_Mm01_00190862 predicted 1512
11 SASI_Mm01_00190859 predicted 583
12 SASI_Mm01_00190863 predicted 552
13 SASI_Mm01_00190864 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021633
VALIDATED
KLHL12 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 12
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1545s21c1
Sequence:CCGGCATACAGGACATTGGACTAATCTCGAGATTAGTCCAATGTCCTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-754s21c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-754s1c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-1142s1c1
Sequence:CCGGCATCACTCGTAAGAGACGTTACTCGAGTAACGTCTCTTACGAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-885s1c1
Sequence:CCGGCCCAGGTATATCACAGATGTACTCGAGTACATCTGTGATATACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2244s1c1
Sequence:CCGGGCAAAGAACTAAGGTGAGTATCTCGAGATACTCACCTTAGTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-886s1c1
Sequence:CCGGCCAGGTATATCACAGATGTAACTCGAGTTACATCTGTGATATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-595s1c1
Sequence:CCGGCTTCTAATTGCCTGGGTATTACTCGAGTAATACCCAGGCAATTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-3025s1c1
Sequence:CCGGCCTGTCCTTTAGTGTAGATTTCTCGAGAAATCTACACTAAAGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1674s1c1
Sequence:CCGGGCATACAACATTCGCACTGATCTCGAGATCAGTGCGAATGTTGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1795s1c1
Sequence:CCGGCCCTGCTAAGTAGCATTGAATCTCGAGATTCAATGCTACTTAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2266s1c1
Sequence:CCGGGCCTACTAGATATGGGCAATACTCGAGTATTGCCCATATCTAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1606s21c1
Sequence:CCGGCCCTGCTGAATGACCATATTTCTCGAGAAATATGGTCATTCAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-1502s21c1
Sequence:CCGGTGACGGCTTGAATATCTTAAACTCGAGTTTAAGATATTCAAGCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1697s1c1
Sequence:CCGGCTGGACAACTGTCACCAGTATCTCGAGATACTGGTGACAGTTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021633.2-1998s21c1
Sequence:CCGGACTATGTGCACCGGGTGATTACTCGAGTAATCACCCGGTGCACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021633
VALIDATED
KLHL12 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 12
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1545s21c1
Sequence:CCGGCATACAGGACATTGGACTAATCTCGAGATTAGTCCAATGTCCTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-754s21c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-754s1c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-1142s1c1
Sequence:CCGGCATCACTCGTAAGAGACGTTACTCGAGTAACGTCTCTTACGAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-885s1c1
Sequence:CCGGCCCAGGTATATCACAGATGTACTCGAGTACATCTGTGATATACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2244s1c1
Sequence:CCGGGCAAAGAACTAAGGTGAGTATCTCGAGATACTCACCTTAGTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-886s1c1
Sequence:CCGGCCAGGTATATCACAGATGTAACTCGAGTTACATCTGTGATATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-595s1c1
Sequence:CCGGCTTCTAATTGCCTGGGTATTACTCGAGTAATACCCAGGCAATTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-3025s1c1
Sequence:CCGGCCTGTCCTTTAGTGTAGATTTCTCGAGAAATCTACACTAAAGGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1674s1c1
Sequence:CCGGGCATACAACATTCGCACTGATCTCGAGATCAGTGCGAATGTTGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1795s1c1
Sequence:CCGGCCCTGCTAAGTAGCATTGAATCTCGAGATTCAATGCTACTTAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2266s1c1
Sequence:CCGGGCCTACTAGATATGGGCAATACTCGAGTATTGCCCATATCTAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1606s21c1
Sequence:CCGGCCCTGCTGAATGACCATATTTCTCGAGAAATATGGTCATTCAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-1502s21c1
Sequence:CCGGTGACGGCTTGAATATCTTAAACTCGAGTTTAAGATATTCAAGCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1697s1c1
Sequence:CCGGCTGGACAACTGTCACCAGTATCTCGAGATACTGGTGACAGTTGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021633.2-1998s21c1
Sequence:CCGGACTATGTGCACCGGGTGATTACTCGAGTAATCACCCGGTGCACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021633
VALIDATED
KLHL12 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 12
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1545s21c1
Sequence:CCGGCATACAGGACATTGGACTAATCTCGAGATTAGTCCAATGTCCTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-754s21c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-754s1c1
Sequence:CCGGGCGACGAAATTCAGGTGGATTCTCGAGAATCCACCTGAATTTCGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-1142s1c1
Sequence:CCGGCATCACTCGTAAGAGACGTTACTCGAGTAACGTCTCTTACGAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-885s1c1
Sequence:CCGGCCCAGGTATATCACAGATGTACTCGAGTACATCTGTGATATACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2244s1c1
Sequence:CCGGGCAAAGAACTAAGGTGAGTATCTCGAGATACTCACCTTAGTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-886s1c1
Sequence:CCGGCCAGGTATATCACAGATGTAACTCGAGTTACATCTGTGATATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021633.2-595s1c1
Sequence:CCGGCTTCTAATTGCCTGGGTATTACTCGAGTAATACCCAGGCAATTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-3025s1c1
Sequence:CCGGCCTGTCCTTTAGTGTAGATTTCTCGAGAAATCTACACTAAAGGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1674s1c1
Sequence:CCGGGCATACAACATTCGCACTGATCTCGAGATCAGTGCGAATGTTGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1795s1c1
Sequence:CCGGCCCTGCTAAGTAGCATTGAATCTCGAGATTCAATGCTACTTAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021633.2-2266s1c1
Sequence:CCGGGCCTACTAGATATGGGCAATACTCGAGTATTGCCCATATCTAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021633.2-1606s21c1
Sequence:CCGGCCCTGCTGAATGACCATATTTCTCGAGAAATATGGTCATTCAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021633.2-1502s21c1
Sequence:CCGGTGACGGCTTGAATATCTTAAACTCGAGTTTAAGATATTCAAGCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021633.2-1697s1c1
Sequence:CCGGCTGGACAACTGTCACCAGTATCTCGAGATACTGGTGACAGTTGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021633.2-1998s21c1
Sequence:CCGGACTATGTGCACCGGGTGATTACTCGAGTAATCACCCGGTGCACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153128
VALIDATED
KLHL12 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-516s1c1
Sequence:CCGGGCCTGCTGTGAGTTCTTAGAACTCGAGTTCTAAGAACTCACAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-840s1c1
Sequence:CCGGCCCAGGTACATTACAGATGTACTCGAGTACATCTGTAATGTACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-2052s1c1
Sequence:CCGGGCACTTTCTTACTGTTTCTAACTCGAGTTAGAAACAGTAAGAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-1673s1c1
Sequence:CCGGGCTGAGCAGCATTGAGTGTTACTCGAGTAACACTCAATGCTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153128.1-1189s1c1
Sequence:CCGGCGGTGGAATGTCTAGACTATACTCGAGTATAGTCTAGACATTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153128
VALIDATED
KLHL12 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-516s1c1
Sequence:CCGGGCCTGCTGTGAGTTCTTAGAACTCGAGTTCTAAGAACTCACAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-840s1c1
Sequence:CCGGCCCAGGTACATTACAGATGTACTCGAGTACATCTGTAATGTACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-2052s1c1
Sequence:CCGGGCACTTTCTTACTGTTTCTAACTCGAGTTAGAAACAGTAAGAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-1673s1c1
Sequence:CCGGGCTGAGCAGCATTGAGTGTTACTCGAGTAACACTCAATGCTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153128.1-1189s1c1
Sequence:CCGGCGGTGGAATGTCTAGACTATACTCGAGTATAGTCTAGACATTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153128
VALIDATED
KLHL12 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-516s1c1
Sequence:CCGGGCCTGCTGTGAGTTCTTAGAACTCGAGTTCTAAGAACTCACAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-840s1c1
Sequence:CCGGCCCAGGTACATTACAGATGTACTCGAGTACATCTGTAATGTACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-2052s1c1
Sequence:CCGGGCACTTTCTTACTGTTTCTAACTCGAGTTAGAAACAGTAAGAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153128.1-1673s1c1
Sequence:CCGGGCTGAGCAGCATTGAGTGTTACTCGAGTAACACTCAATGCTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153128.1-1189s1c1
Sequence:CCGGCGGTGGAATGTCTAGACTATACTCGAGTATAGTCTAGACATTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)