EMAIL THIS PAGE TO A FRIEND

KLHL13

kelch-like family member 13

127 Gene Product Result for
Synonyms: BKLHD2
Gene ID:
Human(90293) Summary: This gene encodes a BTB and kelch domain containing protein and belongs to the kelch repeat domain containing superfamily of proteins. The encoded protein functions as an adaptor protein that complexes with Cullin 3 and other proteins to form the Cullin 3-based E3 ubiquitin-protein ligase complex. This complex is necessary for proper chromosome segregation and completion of cytokinesis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(67455) kelch-like 13
Rat(313445) kelch-like family member 13
chicken(422226) kelch-like 9 (Drosophila)
cow(528138) kelch-like 13 (Drosophila)
Horse(100053772) kelch-like 13 (Drosophila)
domestic cat(101081528) kelch-like 13 (Drosophila)
dog(492088) kelch-like 13 (Drosophila)
domestic guinea pig(100735912) kelch-like family member 13
Domestic Rabbit(100349700) kelch-like 13 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033495 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033495 Rosetta Predictions human pricing
XM_001061200 Rosetta Predictions rat pricing
XM_233297 Rosetta Predictions rat pricing
NM_026167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238415 predicted 1369
2 SASI_Hs01_00238416 predicted 2020
3 SASI_Hs01_00238417 predicted 1036
4 SASI_Hs01_00238418 predicted 357
5 SASI_Hs01_00238419 predicted 648
6 SASI_Hs01_00238420 predicted 812
7 SASI_Hs01_00238421 predicted 1891
8 SASI_Hs01_00238422 predicted 1362
9 SASI_Hs01_00238423 predicted 1119
10 SASI_Hs01_00238424 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299135 predicted 1374
2 SASI_Rn02_00299136 predicted 1320
3 SASI_Rn02_00299137 predicted 2194
4 SASI_Rn02_00299138 predicted 1225
5 SASI_Rn02_00299139 predicted 1647
6 SASI_Rn02_00299140 predicted 1053
7 SASI_Rn02_00299141 predicted 1728
8 SASI_Rn02_00299142 predicted 1279
9 SASI_Rn02_00299143 predicted 1155
10 SASI_Rn02_00299144 predicted 1861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387632 predicted 1374
2 SASI_Rn02_00387633 predicted 1319
3 SASI_Rn02_00387634 predicted 2199
4 SASI_Rn02_00387635 predicted 1647
5 SASI_Rn02_00387636 predicted 1049
6 SASI_Rn02_00387637 predicted 1724
7 SASI_Rn02_00387638 predicted 867
8 SASI_Rn02_00387639 predicted 1284
9 SASI_Rn02_00387640 predicted 1149
10 SASI_Rn02_00387641 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074699 predicted 1120
2 SASI_Mm01_00074700 predicted 1377
3 SASI_Mm01_00074701 predicted 795
4 SASI_Mm01_00074702 predicted 1395
5 SASI_Mm01_00074703 predicted 1068
6 SASI_Mm01_00074704 predicted 899
7 SASI_Mm01_00074705 predicted 1467
8 SASI_Mm01_00074706 predicted 1772
9 SASI_Mm01_00074707 predicted 1758
10 SASI_Mm01_00074708 predicted 1465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026167
KLHL13 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1071s1c1
Sequence:CCGGCTGACAATACTTGCGTCAATTCTCGAGAATTGACGCAAGTATTGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1423s1c1
Sequence:CCGGGATCCAAGTTGCATCTTTAAACTCGAGTTTAAAGATGCAACTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.1-1124s1c1
Sequence:CCGGGCCGTTTATGCAGCCAGTTATCTCGAGATAACTGGCTGCATAAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-348s1c1
Sequence:CCGGGCAGGAAGTACACGCATCTTTCTCGAGAAAGATGCGTGTACTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-779s1c1
Sequence:CCGGCCATCTGACAGAAGTGGATAACTCGAGTTATCCACTTCTGTCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1828s1c1
Sequence:CCGGGCTGTGAATACTACTCACCTACTCGAGTAGGTGAGTAGTATTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026167.1-2226s1c1
Sequence:CCGGCCTTCAGTAATTGATACAGAACTCGAGTTCTGTATCAATTACTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1382s1c1
Sequence:CCGGCGTCGATACAGTGTTTAGATTCTCGAGAATCTAAACACTGTATCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026167
KLHL13 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1071s1c1
Sequence:CCGGCTGACAATACTTGCGTCAATTCTCGAGAATTGACGCAAGTATTGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1423s1c1
Sequence:CCGGGATCCAAGTTGCATCTTTAAACTCGAGTTTAAAGATGCAACTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.1-1124s1c1
Sequence:CCGGGCCGTTTATGCAGCCAGTTATCTCGAGATAACTGGCTGCATAAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-348s1c1
Sequence:CCGGGCAGGAAGTACACGCATCTTTCTCGAGAAAGATGCGTGTACTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-779s1c1
Sequence:CCGGCCATCTGACAGAAGTGGATAACTCGAGTTATCCACTTCTGTCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1828s1c1
Sequence:CCGGGCTGTGAATACTACTCACCTACTCGAGTAGGTGAGTAGTATTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026167.1-2226s1c1
Sequence:CCGGCCTTCAGTAATTGATACAGAACTCGAGTTCTGTATCAATTACTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1382s1c1
Sequence:CCGGCGTCGATACAGTGTTTAGATTCTCGAGAATCTAAACACTGTATCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026167
KLHL13 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1071s1c1
Sequence:CCGGCTGACAATACTTGCGTCAATTCTCGAGAATTGACGCAAGTATTGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.3-1423s1c1
Sequence:CCGGGATCCAAGTTGCATCTTTAAACTCGAGTTTAAAGATGCAACTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026167.1-1124s1c1
Sequence:CCGGGCCGTTTATGCAGCCAGTTATCTCGAGATAACTGGCTGCATAAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-348s1c1
Sequence:CCGGGCAGGAAGTACACGCATCTTTCTCGAGAAAGATGCGTGTACTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-779s1c1
Sequence:CCGGCCATCTGACAGAAGTGGATAACTCGAGTTATCCACTTCTGTCAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1828s1c1
Sequence:CCGGGCTGTGAATACTACTCACCTACTCGAGTAGGTGAGTAGTATTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026167.1-2226s1c1
Sequence:CCGGCCTTCAGTAATTGATACAGAACTCGAGTTCTGTATCAATTACTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026167.1-1382s1c1
Sequence:CCGGCGTCGATACAGTGTTTAGATTCTCGAGAATCTAAACACTGTATCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033495
VALIDATED
KLHL13 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1951s1c1
Sequence:CCGGGTGCTTGCACACTCACAGTTTCTCGAGAAACTGTGAGTGTGCAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-405s1c1
Sequence:CCGGGCTAGTGATTACTTCAAGGCTCTCGAGAGCCTTGAAGTAATCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1878s1c1
Sequence:CCGGGTGCAGAAATATGATCCAGATCTCGAGATCTGGATCATATTTCTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033495.2-93s1c1
Sequence:CCGGGCTATCTGGAAATTCCCAGTTCTCGAGAACTGGGAATTTCCAGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1461s1c1
Sequence:CCGGGAATGGACCTATGTTGCCAAACTCGAGTTTGGCAACATAGGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033495
VALIDATED
KLHL13 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1951s1c1
Sequence:CCGGGTGCTTGCACACTCACAGTTTCTCGAGAAACTGTGAGTGTGCAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-405s1c1
Sequence:CCGGGCTAGTGATTACTTCAAGGCTCTCGAGAGCCTTGAAGTAATCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1878s1c1
Sequence:CCGGGTGCAGAAATATGATCCAGATCTCGAGATCTGGATCATATTTCTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033495.2-93s1c1
Sequence:CCGGGCTATCTGGAAATTCCCAGTTCTCGAGAACTGGGAATTTCCAGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1461s1c1
Sequence:CCGGGAATGGACCTATGTTGCCAAACTCGAGTTTGGCAACATAGGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033495
VALIDATED
KLHL13 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1951s1c1
Sequence:CCGGGTGCTTGCACACTCACAGTTTCTCGAGAAACTGTGAGTGTGCAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-405s1c1
Sequence:CCGGGCTAGTGATTACTTCAAGGCTCTCGAGAGCCTTGAAGTAATCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1878s1c1
Sequence:CCGGGTGCAGAAATATGATCCAGATCTCGAGATCTGGATCATATTTCTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033495.2-93s1c1
Sequence:CCGGGCTATCTGGAAATTCCCAGTTCTCGAGAACTGGGAATTTCCAGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033495.2-1461s1c1
Sequence:CCGGGAATGGACCTATGTTGCCAAACTCGAGTTTGGCAACATAGGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)