EMAIL THIS PAGE TO A FRIEND

KLHL14

kelch-like family member 14

162 Gene Product Result for
UniProtKB ID: Q9P2G3, A6NNW1, B4DHA0, Q8WU41
Gene ID:
Mouse(225266) kelch-like 14
Rat(364823) kelch-like family member 14
sheep(101117636) kelch-like 14 (Drosophila)
domestic guinea pig(100714868) kelch-like family member 14
naked mole-rat(101719850) kelch-like family member 14
chicken(421100) kelch-like 14 (Drosophila)
domestic cat(101087357) kelch-like 14 (Drosophila)
cow(517316) kelch-like 14 (Drosophila)
dog(490494) kelch-like 14 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020805 Rosetta Predictions human pricing
NM_001108885 Rosetta Predictions rat pricing
NM_001081403 Rosetta Predictions mouse pricing
XM_979146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176340 predicted 1708
2 SASI_Hs01_00176342 predicted 1397
3 SASI_Hs01_00176343 predicted 1847
4 SASI_Hs01_00176344 predicted 2132
5 SASI_Hs01_00176345 predicted 2135
6 SASI_Hs01_00176346 predicted 1395
7 SASI_Hs01_00176347 predicted 2349
8 SASI_Hs02_00353981 predicted 2274
9 SASI_Hs01_00176348 predicted 1916
10 SASI_Hs01_00176349 predicted 1741
11 SASI_Hs01_00176341 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243045 predicted 1090
2 SASI_Rn02_00243046 predicted 1402
3 SASI_Rn02_00243047 predicted 1650
4 SASI_Rn02_00243048 predicted 1519
5 SASI_Rn02_00243049 predicted 1826
6 SASI_Rn02_00243050 predicted 1868
7 SASI_Rn02_00243051 predicted 848
8 SASI_Rn02_00243052 predicted 1634
9 SASI_Rn02_00243053 predicted 2042
10 SASI_Rn02_00243054 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298051 predicted 1014
2 SASI_Mm02_00298052 predicted 1986
3 SASI_Mm02_00298053 predicted 1528
4 SASI_Mm02_00298054 predicted 1332
5 SASI_Mm02_00298055 predicted 1017
6 SASI_Mm02_00298056 predicted 1197
7 SASI_Mm02_00298057 predicted 1018
8 SASI_Mm02_00298058 predicted 1800
9 SASI_Mm02_00298059 predicted 952
10 SASI_Mm02_00298060 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226417 predicted 1018
2 SASI_Mm01_00226418 predicted 1998
3 SASI_Mm01_00226419 predicted 1536
4 SASI_Mm01_00226420 predicted 1338
5 SASI_Mm01_00226421 predicted 1021
6 SASI_Mm01_00226422 predicted 1207
7 SASI_Mm01_00226423 predicted 1023
8 SASI_Mm01_00226424 predicted 1798
9 SASI_Mm01_00226425 predicted 956
10 SASI_Mm01_00226426 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081403
KLHL14 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081403.1-2711s21c1
Sequence:CCGGGTTCCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1454s21c1
Sequence:CCGGAGTACGTCCCATGGTTGTATTCTCGAGAATACAACCATGGGACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-408s21c1
Sequence:CCGGGCTGCGCCTAGTGCTTGAATACTCGAGTATTCAAGCACTAGGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1265s21c1
Sequence:CCGGGCCGCTTGGACAAGCATTTATCTCGAGATAAATGCTTGTCCAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1569s21c1
Sequence:CCGGCGCAATCGGAGGGAATCATTTCTCGAGAAATGATTCCCTCCGATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081403
KLHL14 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081403.1-2711s21c1
Sequence:CCGGGTTCCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1454s21c1
Sequence:CCGGAGTACGTCCCATGGTTGTATTCTCGAGAATACAACCATGGGACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-408s21c1
Sequence:CCGGGCTGCGCCTAGTGCTTGAATACTCGAGTATTCAAGCACTAGGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1265s21c1
Sequence:CCGGGCCGCTTGGACAAGCATTTATCTCGAGATAAATGCTTGTCCAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1569s21c1
Sequence:CCGGCGCAATCGGAGGGAATCATTTCTCGAGAAATGATTCCCTCCGATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081403
KLHL14 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081403.1-2711s21c1
Sequence:CCGGGTTCCAACTTTAATCCATAATCTCGAGATTATGGATTAAAGTTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1454s21c1
Sequence:CCGGAGTACGTCCCATGGTTGTATTCTCGAGAATACAACCATGGGACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-408s21c1
Sequence:CCGGGCTGCGCCTAGTGCTTGAATACTCGAGTATTCAAGCACTAGGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1265s21c1
Sequence:CCGGGCCGCTTGGACAAGCATTTATCTCGAGATAAATGCTTGTCCAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081403.1-1569s21c1
Sequence:CCGGCGCAATCGGAGGGAATCATTTCTCGAGAAATGATTCCCTCCGATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020805
KLHL14 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2248s1c1
Sequence:CCGGGCCCTCTTGTGTACCATACAACTCGAGTTGTATGGTACACAAGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1401s1c1
Sequence:CCGGCCAGCAATTTGGTTCAGTATTCTCGAGAATACTGAACCAAATTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2089s1c1
Sequence:CCGGGCTTGATGACAGCATTTACCTCTCGAGAGGTAAATGCTGTCATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3744s1c1
Sequence:CCGGCGATGCCGTTTCTACAGTAAACTCGAGTTTACTGTAGAAACGGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1583s1c1
Sequence:CCGGCCTCGATTTAATAGCTGGATTCTCGAGAATCCAGCTATTAAATCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3553s1c1
Sequence:CCGGCCAGAGCTTGAACAACAACTTCTCGAGAAGTTGTTGTTCAAGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-2726s1c1
Sequence:CCGGGCCACTTGATTCTGTACTCTTCTCGAGAAGAGTACAGAATCAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2160s1c1
Sequence:CCGGGCTATTGTCCAGAGAAAGGAACTCGAGTTCCTTTCTCTGGACAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1727s1c1
Sequence:CCGGGAAACGAATGAATGGCGCTATCTCGAGATAGCGCCATTCATTCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020805
KLHL14 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2248s1c1
Sequence:CCGGGCCCTCTTGTGTACCATACAACTCGAGTTGTATGGTACACAAGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1401s1c1
Sequence:CCGGCCAGCAATTTGGTTCAGTATTCTCGAGAATACTGAACCAAATTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2089s1c1
Sequence:CCGGGCTTGATGACAGCATTTACCTCTCGAGAGGTAAATGCTGTCATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3744s1c1
Sequence:CCGGCGATGCCGTTTCTACAGTAAACTCGAGTTTACTGTAGAAACGGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1583s1c1
Sequence:CCGGCCTCGATTTAATAGCTGGATTCTCGAGAATCCAGCTATTAAATCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3553s1c1
Sequence:CCGGCCAGAGCTTGAACAACAACTTCTCGAGAAGTTGTTGTTCAAGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-2726s1c1
Sequence:CCGGGCCACTTGATTCTGTACTCTTCTCGAGAAGAGTACAGAATCAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2160s1c1
Sequence:CCGGGCTATTGTCCAGAGAAAGGAACTCGAGTTCCTTTCTCTGGACAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1727s1c1
Sequence:CCGGGAAACGAATGAATGGCGCTATCTCGAGATAGCGCCATTCATTCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020805
KLHL14 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2248s1c1
Sequence:CCGGGCCCTCTTGTGTACCATACAACTCGAGTTGTATGGTACACAAGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1401s1c1
Sequence:CCGGCCAGCAATTTGGTTCAGTATTCTCGAGAATACTGAACCAAATTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2089s1c1
Sequence:CCGGGCTTGATGACAGCATTTACCTCTCGAGAGGTAAATGCTGTCATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3744s1c1
Sequence:CCGGCGATGCCGTTTCTACAGTAAACTCGAGTTTACTGTAGAAACGGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1583s1c1
Sequence:CCGGCCTCGATTTAATAGCTGGATTCTCGAGAATCCAGCTATTAAATCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-3553s1c1
Sequence:CCGGCCAGAGCTTGAACAACAACTTCTCGAGAAGTTGTTGTTCAAGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020805.1-2726s1c1
Sequence:CCGGGCCACTTGATTCTGTACTCTTCTCGAGAAGAGTACAGAATCAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-2160s1c1
Sequence:CCGGGCTATTGTCCAGAGAAAGGAACTCGAGTTCCTTTCTCTGGACAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020805.1-1727s1c1
Sequence:CCGGGAAACGAATGAATGGCGCTATCTCGAGATAGCGCCATTCATTCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)