EMAIL THIS PAGE TO A FRIEND

KLHL15

kelch-like family member 15

302 Gene Product Result for
UniProtKB ID: Q96M94, Q32MN3, Q8NDA3, Q96BM6, Q9C0I6
Gene ID:
Human(80311) Summary: This gene encodes a member of the kelch-like family of proteins that share a common domain structure consisting of an N-terminal broad-complex, tramtrack, bric-a-brac/poxvirus and zinc finger domain and C-terminal kelch repeat motifs. The encoded protein may be involved in protein ubiquitination and cytoskeletal organization. [provided by RefSeq, Apr 2009]
Mouse(236904) kelch-like 15
Rat(314111) kelch-like family member 15
Zebrafish(445186) kelch-like 15 (Drosophila)
domestic cat(101094400) kelch-like 15 (Drosophila)
cow(540246) kelch-like 15 (Drosophila)
Horse(100052043) kelch-like 15 (Drosophila)
dog(491777) kelch-like 15 (Drosophila)
chicken(418598) kelch-like 15 (Drosophila)
domestic guinea pig(100716062) kelch-like family member 15
naked mole-rat(101697259) kelch-like family member 15
sheep(101114417) kelch-like 15 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030624 Rosetta Predictions human pricing
NM_001108021 Rosetta Predictions rat pricing
NM_001039059 Rosetta Predictions mouse pricing
NM_001039060 Rosetta Predictions mouse pricing
NM_001039061 Rosetta Predictions mouse pricing
NM_153165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206554 predicted 533
2 SASI_Hs01_00206556 predicted 477
3 SASI_Hs01_00206557 predicted 1643
4 SASI_Hs01_00206558 predicted 1428
5 SASI_Hs01_00206559 predicted 1361
6 SASI_Hs01_00206561 predicted 316
7 SASI_Hs01_00206562 predicted 1688
8 SASI_Hs02_00358181 predicted 713
9 SASI_Hs01_00206563 predicted 1173
10 SASI_Hs02_00358182 predicted 1783
11 SASI_Hs01_00206555 predicted 1713
12 SASI_Hs01_00206560 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234585 predicted 406
2 SASI_Rn02_00234586 predicted 1312
3 SASI_Rn02_00234587 predicted 1626
4 SASI_Rn02_00234588 predicted 1113
5 SASI_Rn02_00234589 predicted 589
6 SASI_Rn02_00234590 predicted 519
7 SASI_Rn02_00234591 predicted 1642
8 SASI_Rn02_00234592 predicted 1509
9 SASI_Rn02_00234593 predicted 943
10 SASI_Rn02_00234594 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155607 predicted 725
2 SASI_Mm01_00155608 predicted 720
3 SASI_Mm01_00155609 predicted 815
4 SASI_Mm01_00155610 predicted 620
5 SASI_Mm01_00155612 predicted 718
6 SASI_Mm01_00155613 predicted 646
7 SASI_Mm01_00155615 predicted 685
8 SASI_Mm02_00289746 predicted 693
9 SASI_Mm01_00155616 predicted 799
10 SASI_Mm02_00289747 predicted 672
11 SASI_Mm01_00155611 predicted 808
12 SASI_Mm01_00155614 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077486 predicted 771
2 SASI_Mm01_00077487 predicted 773
3 SASI_Mm01_00077488 predicted 869
4 SASI_Mm01_00077489 predicted 671
5 SASI_Mm01_00077491 predicted 769
6 SASI_Mm01_00077492 predicted 694
7 SASI_Mm01_00077494 predicted 737
8 SASI_Mm02_00289748 predicted 742
9 SASI_Mm01_00077495 predicted 852
10 SASI_Mm02_00289749 predicted 727
11 SASI_Mm01_00077490 predicted 857
12 SASI_Mm01_00077493 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128368 predicted 812
2 SASI_Mm01_00128369 predicted 820
3 SASI_Mm01_00128370 predicted 907
4 SASI_Mm01_00128371 predicted 719
5 SASI_Mm01_00128373 predicted 811
6 SASI_Mm01_00128374 predicted 745
7 SASI_Mm01_00128376 predicted 779
8 SASI_Mm02_00289750 predicted 791
9 SASI_Mm01_00128377 predicted 897
10 SASI_Mm02_00289751 predicted 770
11 SASI_Mm01_00128372 predicted 898
12 SASI_Mm01_00128375 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173206 predicted 770
2 SASI_Mm01_00173207 predicted 774
3 SASI_Mm01_00173208 predicted 861
4 SASI_Mm01_00173209 predicted 679
5 SASI_Mm01_00173211 predicted 766
6 SASI_Mm01_00173212 predicted 703
7 SASI_Mm01_00173214 predicted 736
8 SASI_Mm02_00343074 predicted 741
9 SASI_Mm01_00173215 predicted 848
10 SASI_Mm02_00343075 predicted 726
11 SASI_Mm01_00173210 predicted 860
12 SASI_Mm01_00173213 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153165
KLHL15 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.2-728s1c1
Sequence:CCGGGGAACTATAGAACTAAGTATGCTCGAGCATACTTAGTTCTATAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153165.2-1208s1c1
Sequence:CCGGGCTTTAGTTACCAGATCTTATCTCGAGATAAGATCTGGTAACTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-919s1c1
Sequence:CCGGCTTCGAGAAGCTCATGTCTTACTCGAGTAAGACATGAGCTTCTCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-928s1c1
Sequence:CCGGGCTCATGTCTTATTTGGATAACTCGAGTTATCCAAATAAGACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-710s1c1
Sequence:CCGGGCAGCAATGTATGTTCAGCTTCTCGAGAAGCTGAACATACATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-713s1c1
Sequence:CCGGGCAATGTATGTTCAGCTTATACTCGAGTATAAGCTGAACATACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-808s1c1
Sequence:CCGGGTTAGATGATTTCGGTGTTAACTCGAGTTAACACCGAAATCATCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.1-1084s1c1
Sequence:CCGGCGTCTTTGAGAAGACATCGTACTCGAGTACGATGTCTTCTCAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153165
KLHL15 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.2-728s1c1
Sequence:CCGGGGAACTATAGAACTAAGTATGCTCGAGCATACTTAGTTCTATAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153165.2-1208s1c1
Sequence:CCGGGCTTTAGTTACCAGATCTTATCTCGAGATAAGATCTGGTAACTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-919s1c1
Sequence:CCGGCTTCGAGAAGCTCATGTCTTACTCGAGTAAGACATGAGCTTCTCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-928s1c1
Sequence:CCGGGCTCATGTCTTATTTGGATAACTCGAGTTATCCAAATAAGACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-710s1c1
Sequence:CCGGGCAGCAATGTATGTTCAGCTTCTCGAGAAGCTGAACATACATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-713s1c1
Sequence:CCGGGCAATGTATGTTCAGCTTATACTCGAGTATAAGCTGAACATACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-808s1c1
Sequence:CCGGGTTAGATGATTTCGGTGTTAACTCGAGTTAACACCGAAATCATCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.1-1084s1c1
Sequence:CCGGCGTCTTTGAGAAGACATCGTACTCGAGTACGATGTCTTCTCAAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153165
KLHL15 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.2-728s1c1
Sequence:CCGGGGAACTATAGAACTAAGTATGCTCGAGCATACTTAGTTCTATAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215471    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153165.2-1208s1c1
Sequence:CCGGGCTTTAGTTACCAGATCTTATCTCGAGATAAGATCTGGTAACTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-919s1c1
Sequence:CCGGCTTCGAGAAGCTCATGTCTTACTCGAGTAAGACATGAGCTTCTCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-928s1c1
Sequence:CCGGGCTCATGTCTTATTTGGATAACTCGAGTTATCCAAATAAGACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-710s1c1
Sequence:CCGGGCAGCAATGTATGTTCAGCTTCTCGAGAAGCTGAACATACATTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-713s1c1
Sequence:CCGGGCAATGTATGTTCAGCTTATACTCGAGTATAAGCTGAACATACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153165.1-808s1c1
Sequence:CCGGGTTAGATGATTTCGGTGTTAACTCGAGTTAACACCGAAATCATCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153165.1-1084s1c1
Sequence:CCGGCGTCTTTGAGAAGACATCGTACTCGAGTACGATGTCTTCTCAAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030624
VALIDATED
KLHL15 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-1638s1c1
Sequence:CCGGCTCAAGTGGTTACCAACTGTTCTCGAGAACAGTTGGTAACCACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1761s1c1
Sequence:CCGGCCTCTTTCGAATCTCAGGGATCTCGAGATCCCTGAGATTCGAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1671s1c1
Sequence:CCGGGCAAGATGAATTACGCGAGATCTCGAGATCTCGCGTAATTCATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-541s1c1
Sequence:CCGGGCTGAGTATGAATACCGTTCACTCGAGTGAACGGTATTCATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1924s1c1
Sequence:CCGGCAGCGATTCCATCCTCACTTTCTCGAGAAAGTGAGGATGGAATCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-1365s1c1
Sequence:CCGGCTGAATTTGCTGTAGGTGTTACTCGAGTAACACCTACAGCAAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-542s1c1
Sequence:CCGGCTGAGTATGAATACCGTTCATCTCGAGATGAACGGTATTCATACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030624
VALIDATED
KLHL15 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-1638s1c1
Sequence:CCGGCTCAAGTGGTTACCAACTGTTCTCGAGAACAGTTGGTAACCACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1761s1c1
Sequence:CCGGCCTCTTTCGAATCTCAGGGATCTCGAGATCCCTGAGATTCGAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1671s1c1
Sequence:CCGGGCAAGATGAATTACGCGAGATCTCGAGATCTCGCGTAATTCATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-541s1c1
Sequence:CCGGGCTGAGTATGAATACCGTTCACTCGAGTGAACGGTATTCATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1924s1c1
Sequence:CCGGCAGCGATTCCATCCTCACTTTCTCGAGAAAGTGAGGATGGAATCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-1365s1c1
Sequence:CCGGCTGAATTTGCTGTAGGTGTTACTCGAGTAACACCTACAGCAAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-542s1c1
Sequence:CCGGCTGAGTATGAATACCGTTCATCTCGAGATGAACGGTATTCATACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030624
VALIDATED
KLHL15 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-1638s1c1
Sequence:CCGGCTCAAGTGGTTACCAACTGTTCTCGAGAACAGTTGGTAACCACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1761s1c1
Sequence:CCGGCCTCTTTCGAATCTCAGGGATCTCGAGATCCCTGAGATTCGAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1671s1c1
Sequence:CCGGGCAAGATGAATTACGCGAGATCTCGAGATCTCGCGTAATTCATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030624.1-541s1c1
Sequence:CCGGGCTGAGTATGAATACCGTTCACTCGAGTGAACGGTATTCATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030624.1-1924s1c1
Sequence:CCGGCAGCGATTCCATCCTCACTTTCTCGAGAAAGTGAGGATGGAATCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-1365s1c1
Sequence:CCGGCTGAATTTGCTGTAGGTGTTACTCGAGTAACACCTACAGCAAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_030624.1-542s1c1
Sequence:CCGGCTGAGTATGAATACCGTTCATCTCGAGATGAACGGTATTCATACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)