EMAIL THIS PAGE TO A FRIEND

KLHL17

kelch-like family member 17

100 Gene Product Result for
Synonyms: RP11-54O7.6
UniProtKB ID: Q6TDP4, Q5SV94
Gene ID:
Human(339451) Summary: The protein encoded by this gene is expressed in neurons of most regions of the brain. It contains an N-terminal BTB domain, which mediates dimerization of the protein, and a C-terminal Kelch domain, which mediates binding to F-actin. This protein may play a key role in the regulation of actin-based neuronal function. [provided by RefSeq, Aug 2010]
Mouse(231003) kelch-like 17
Rat(246757) kelch-like family member 17
sheep(101108068) kelch-like 17 (Drosophila)
domestic guinea pig(100731883) kelch-like family member 17
naked mole-rat(101696952) kelch-like family member 17
Zebrafish(336187) kelch-like 17 (Drosophila)
cow(615476) kelch-like 17 (Drosophila)
Horse(100146295) kelch-like 17 (Drosophila)
domestic cat(101100289) kelch-like 17 (Drosophila)
dog(489607) kelch-like 17 (Drosophila)
chicken(419432) kelch-like 17 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031251 Anti-KLHL17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198317 Rosetta Predictions human pricing
NM_145671 Rosetta Predictions rat pricing
NM_198305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135824 predicted 823
2 SASI_Hs02_00371868 predicted 834
3 SASI_Hs01_00135825 predicted 1398
4 SASI_Hs01_00135826 predicted 960
5 SASI_Hs01_00135827 predicted 1744
6 SASI_Hs01_00135828 predicted 1073
7 SASI_Hs01_00135829 predicted 1283
8 SASI_Hs01_00135830 predicted 1774
9 SASI_Hs01_00135831 predicted 1776
10 SASI_Hs01_00135832 predicted 647
11 SASI_Hs01_00135833 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077133 predicted 1275
2 SASI_Rn01_00077134 predicted 806
3 SASI_Rn01_00077135 predicted 257
4 SASI_Rn01_00077136 predicted 988
5 SASI_Rn01_00077137 predicted 772
6 SASI_Rn01_00077138 predicted 451
7 SASI_Rn01_00077139 predicted 595
8 SASI_Rn01_00077140 predicted 1229
9 SASI_Rn01_00077141 predicted 1402
10 SASI_Rn01_00077142 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171132 predicted 1511
2 SASI_Mm01_00171133 predicted 1294
3 SASI_Mm01_00171134 predicted 785
4 SASI_Mm01_00171136 predicted 1698
5 SASI_Mm01_00171137 predicted 526
6 SASI_Mm01_00171138 predicted 933
7 SASI_Mm01_00171139 predicted 617
8 SASI_Mm01_00171140 predicted 1416
9 SASI_Mm01_00171141 predicted 822
10 SASI_Mm02_00350936 predicted 267
11 SASI_Mm01_00171135 predicted 1775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198317
KLHL17 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-1546s21c1
Sequence:CCGGCGCTTGATGGGAACCTGTATGCTCGAGCATACAGGTTCCCATCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2130s1c1
Sequence:CCGGGCATCCATTCCTTCATGTCTTCTCGAGAAGACATGAAGGAATGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-656s1c1
Sequence:CCGGGTTTCTACTGAGTCAGCTCGACTCGAGTCGAGCTGACTCAGTAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198317.1-2211s21c1
Sequence:CCGGGGCTGCCCGTTTACACCTTTACTCGAGTAAAGGTGTAAACGGGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-925s21c1
Sequence:CCGGATGTCCCACGGCTCATGAAGTCTCGAGACTTCATGAGCCGTGGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2118s1c1
Sequence:CCGGGTTCACGTCTCTGCATCCATTCTCGAGAATGGATGCAGAGACGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1744s1c1
Sequence:CCGGCGGTAGAGAGATACAGTCCAACTCGAGTTGGACTGTATCTCTCTACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-458s1c1
Sequence:CCGGCCACGCCATGTTCACAAATGACTCGAGTCATTTGTGAACATGGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1877s1c1
Sequence:CCGGCCTCAACTCCATCGAGAAGTACTCGAGTACTTCTCGATGGAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1880s1c1
Sequence:CCGGCAACTCCATCGAGAAGTACAACTCGAGTTGTACTTCTCGATGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198317
KLHL17 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-1546s21c1
Sequence:CCGGCGCTTGATGGGAACCTGTATGCTCGAGCATACAGGTTCCCATCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2130s1c1
Sequence:CCGGGCATCCATTCCTTCATGTCTTCTCGAGAAGACATGAAGGAATGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-656s1c1
Sequence:CCGGGTTTCTACTGAGTCAGCTCGACTCGAGTCGAGCTGACTCAGTAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198317.1-2211s21c1
Sequence:CCGGGGCTGCCCGTTTACACCTTTACTCGAGTAAAGGTGTAAACGGGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-925s21c1
Sequence:CCGGATGTCCCACGGCTCATGAAGTCTCGAGACTTCATGAGCCGTGGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2118s1c1
Sequence:CCGGGTTCACGTCTCTGCATCCATTCTCGAGAATGGATGCAGAGACGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1744s1c1
Sequence:CCGGCGGTAGAGAGATACAGTCCAACTCGAGTTGGACTGTATCTCTCTACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-458s1c1
Sequence:CCGGCCACGCCATGTTCACAAATGACTCGAGTCATTTGTGAACATGGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1877s1c1
Sequence:CCGGCCTCAACTCCATCGAGAAGTACTCGAGTACTTCTCGATGGAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1880s1c1
Sequence:CCGGCAACTCCATCGAGAAGTACAACTCGAGTTGTACTTCTCGATGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198317
KLHL17 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-1546s21c1
Sequence:CCGGCGCTTGATGGGAACCTGTATGCTCGAGCATACAGGTTCCCATCAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000155542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2130s1c1
Sequence:CCGGGCATCCATTCCTTCATGTCTTCTCGAGAAGACATGAAGGAATGGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-656s1c1
Sequence:CCGGGTTTCTACTGAGTCAGCTCGACTCGAGTCGAGCTGACTCAGTAGAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198317.1-2211s21c1
Sequence:CCGGGGCTGCCCGTTTACACCTTTACTCGAGTAAAGGTGTAAACGGGCAGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198317.1-925s21c1
Sequence:CCGGATGTCCCACGGCTCATGAAGTCTCGAGACTTCATGAGCCGTGGGACATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198317.1-2118s1c1
Sequence:CCGGGTTCACGTCTCTGCATCCATTCTCGAGAATGGATGCAGAGACGTGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1744s1c1
Sequence:CCGGCGGTAGAGAGATACAGTCCAACTCGAGTTGGACTGTATCTCTCTACCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000157901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-458s1c1
Sequence:CCGGCCACGCCATGTTCACAAATGACTCGAGTCATTTGTGAACATGGCGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1877s1c1
Sequence:CCGGCCTCAACTCCATCGAGAAGTACTCGAGTACTTCTCGATGGAGTTGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000156131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198317.1-1880s1c1
Sequence:CCGGCAACTCCATCGAGAAGTACAACTCGAGTTGTACTTCTCGATGGAGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198305
KLHL17 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198305.1-2147s1c1
Sequence:CCGGCGGTGTTCATTTGTCCTCGTTCTCGAGAACGAGGACAAATGAACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1846s1c1
Sequence:CCGGCAACTCCATAGAGAAGTACAACTCGAGTTGTACTTCTCTATGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-590s1c1
Sequence:CCGGCAGTTGAATGGTGTTCGAGATCTCGAGATCTCGAACACCATTCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-896s1c1
Sequence:CCGGCCAAGGTTGATGAAGTGTGTACTCGAGTACACACTTCATCAACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-787s1c1
Sequence:CCGGGCTGGAATTGGTCTCTAGTGACTCGAGTCACTAGAGACCAATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1705s1c1
Sequence:CCGGCAACTCAGTGGAGAGATATAGCTCGAGCTATATCTCTCCACTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-889s1c1
Sequence:CCGGGCATGTACCAAGGTTGATGAACTCGAGTTCATCAACCTTGGTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198305
KLHL17 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198305.1-2147s1c1
Sequence:CCGGCGGTGTTCATTTGTCCTCGTTCTCGAGAACGAGGACAAATGAACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1846s1c1
Sequence:CCGGCAACTCCATAGAGAAGTACAACTCGAGTTGTACTTCTCTATGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-590s1c1
Sequence:CCGGCAGTTGAATGGTGTTCGAGATCTCGAGATCTCGAACACCATTCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-896s1c1
Sequence:CCGGCCAAGGTTGATGAAGTGTGTACTCGAGTACACACTTCATCAACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-787s1c1
Sequence:CCGGGCTGGAATTGGTCTCTAGTGACTCGAGTCACTAGAGACCAATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1705s1c1
Sequence:CCGGCAACTCAGTGGAGAGATATAGCTCGAGCTATATCTCTCCACTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-889s1c1
Sequence:CCGGGCATGTACCAAGGTTGATGAACTCGAGTTCATCAACCTTGGTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198305
KLHL17 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198305.1-2147s1c1
Sequence:CCGGCGGTGTTCATTTGTCCTCGTTCTCGAGAACGAGGACAAATGAACACCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1846s1c1
Sequence:CCGGCAACTCCATAGAGAAGTACAACTCGAGTTGTACTTCTCTATGGAGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-590s1c1
Sequence:CCGGCAGTTGAATGGTGTTCGAGATCTCGAGATCTCGAACACCATTCAACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-896s1c1
Sequence:CCGGCCAAGGTTGATGAAGTGTGTACTCGAGTACACACTTCATCAACCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000194559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-787s1c1
Sequence:CCGGGCTGGAATTGGTCTCTAGTGACTCGAGTCACTAGAGACCAATTCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-1705s1c1
Sequence:CCGGCAACTCAGTGGAGAGATATAGCTCGAGCTATATCTCTCCACTGAGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198305.1-889s1c1
Sequence:CCGGGCATGTACCAAGGTTGATGAACTCGAGTTCATCAACCTTGGTACATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???