EMAIL THIS PAGE TO A FRIEND

KLHL18

kelch-like family member 18

235 Gene Product Result for
UniProtKB ID: O94889, A8K612, Q7Z3E8, Q8N125
Gene ID:
Mouse(270201) kelch-like 18
Rat(316012) kelch-like family member 18
Zebrafish(327574) kelch-like 18 (Drosophila)
chicken(420406) kelch-like 18 (Drosophila)
dog(484783) kelch-like 18 (Drosophila)
fruit fly(41458) CG3571 gene product from transcript CG3571-RC
cow(517831) kelch-like 18 (Drosophila)
domestic cat(101085787) kelch-like 18 (Drosophila)
domestic guinea pig(100719909) kelch-like family member 18
naked mole-rat(101710603) kelch-like family member 18
sheep(101123077) kelch-like 18 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025010 Rosetta Predictions human pricing
XM_001077154 Rosetta Predictions rat pricing
XM_236647 Rosetta Predictions rat pricing
NM_177771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157621 predicted 282
2 SASI_Hs02_00357674 predicted 1073
3 SASI_Hs01_00157622 predicted 961
4 SASI_Hs01_00157623 predicted 280
5 SASI_Hs01_00157624 predicted 1281
6 SASI_Hs01_00157625 predicted 201
7 SASI_Hs01_00157626 predicted 244
8 SASI_Hs01_00157627 predicted 1285
9 SASI_Hs01_00157628 predicted 905
10 SASI_Hs01_00157629 predicted 947
11 SASI_Hs01_00157630 predicted 2183
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077154 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355970 predicted 269
2 SASI_Rn02_00355971 predicted 366
3 SASI_Rn02_00355972 predicted 350
4 SASI_Rn02_00355973 predicted 1142
5 SASI_Rn02_00355974 predicted 1563
6 SASI_Rn02_00355975 predicted 309
7 SASI_Rn02_00355976 predicted 982
8 SASI_Rn02_00355977 predicted 533
9 SASI_Rn02_00355978 predicted 1287
10 SASI_Rn02_00355979 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390259 predicted 273
2 SASI_Rn02_00390260 predicted 228
3 SASI_Rn02_00390261 predicted 359
4 SASI_Rn02_00390262 predicted 511
5 SASI_Rn02_00390263 predicted 820
6 SASI_Rn02_00390264 predicted 303
7 SASI_Rn02_00390265 predicted 917
8 SASI_Rn02_00390266 predicted 355
9 SASI_Rn02_00390267 predicted 338
10 SASI_Rn02_00390268 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126501 predicted 1162
2 SASI_Mm02_00348155 predicted 1991
3 SASI_Mm01_00126502 predicted 882
4 SASI_Mm01_00126503 predicted 1550
5 SASI_Mm01_00126504 predicted 291
6 SASI_Mm01_00126505 predicted 326
7 SASI_Mm01_00126506 predicted 997
8 SASI_Mm01_00126507 predicted 861
9 SASI_Mm01_00126508 predicted 2073
10 SASI_Mm02_00348156 predicted 2048
11 SASI_Mm01_00126499 predicted 380
12 SASI_Mm01_00126500 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025010
VALIDATED
KLHL18 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 18
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-294s21c1
Sequence:CCGGAGCAGCCTCGATCCCGTATTTCTCGAGAAATACGGGATCGAGGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1403s21c1
Sequence:CCGGCAGTCTTTGAGGGCAGGATATCTCGAGATATCCTGCCCTCAAAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-400s21c1
Sequence:CCGGCTGATCAACTTTGCCTACAACCTCGAGGTTGTAGGCAAAGTTGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-863s21c1
Sequence:CCGGTGGTGCGTTGCTGCCACAAATCTCGAGATTTGTGGCAGCAACGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1364s21c1
Sequence:CCGGTGACCTCGATGAGCTCGAATCCTCGAGGATTCGAGCTCATCGAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-872s1c1
Sequence:CCGGCATCCATCGCTGGACTTATCTCTCGAGAGATAAGTCCAGCGATGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025010.1-880s1c1
Sequence:CCGGGCTGGACTTATCTACGCTGTACTCGAGTACAGCGTAGATAAGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-618s1c1
Sequence:CCGGGCAGGTCTTTGAAGCTGCATTCTCGAGAATGCAGCTTCAAAGACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-1137s1c1
Sequence:CCGGGAGAAGGTATTCTGGAAGCCACTCGAGTGGCTTCCAGAATACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-606s1c1
Sequence:CCGGCAAATCTGAGGAGCAGGTCTTCTCGAGAAGACCTGCTCCTCAGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-592s1c1
Sequence:CCGGGATGAGCTGAATGTCAAATCTCTCGAGAGATTTGACATTCAGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-1122s1c1
Sequence:CCGGGAGCATGAATAGCAAGAGAAGCTCGAGCTTCTCTTGCTATTCATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-723s1c1
Sequence:CCGGCCAGTTCCTTTCAGACAGAATCTCGAGATTCTGTCTGAAAGGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-729s1c1
Sequence:CCGGCCTTTCAGACAGAATACAGCACTCGAGTGCTGTATTCTGTCTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025010
VALIDATED
KLHL18 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 18
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-294s21c1
Sequence:CCGGAGCAGCCTCGATCCCGTATTTCTCGAGAAATACGGGATCGAGGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1403s21c1
Sequence:CCGGCAGTCTTTGAGGGCAGGATATCTCGAGATATCCTGCCCTCAAAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-400s21c1
Sequence:CCGGCTGATCAACTTTGCCTACAACCTCGAGGTTGTAGGCAAAGTTGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-863s21c1
Sequence:CCGGTGGTGCGTTGCTGCCACAAATCTCGAGATTTGTGGCAGCAACGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1364s21c1
Sequence:CCGGTGACCTCGATGAGCTCGAATCCTCGAGGATTCGAGCTCATCGAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-872s1c1
Sequence:CCGGCATCCATCGCTGGACTTATCTCTCGAGAGATAAGTCCAGCGATGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025010.1-880s1c1
Sequence:CCGGGCTGGACTTATCTACGCTGTACTCGAGTACAGCGTAGATAAGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-618s1c1
Sequence:CCGGGCAGGTCTTTGAAGCTGCATTCTCGAGAATGCAGCTTCAAAGACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-1137s1c1
Sequence:CCGGGAGAAGGTATTCTGGAAGCCACTCGAGTGGCTTCCAGAATACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-606s1c1
Sequence:CCGGCAAATCTGAGGAGCAGGTCTTCTCGAGAAGACCTGCTCCTCAGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-592s1c1
Sequence:CCGGGATGAGCTGAATGTCAAATCTCTCGAGAGATTTGACATTCAGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-1122s1c1
Sequence:CCGGGAGCATGAATAGCAAGAGAAGCTCGAGCTTCTCTTGCTATTCATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-723s1c1
Sequence:CCGGCCAGTTCCTTTCAGACAGAATCTCGAGATTCTGTCTGAAAGGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-729s1c1
Sequence:CCGGCCTTTCAGACAGAATACAGCACTCGAGTGCTGTATTCTGTCTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025010
VALIDATED
KLHL18 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 18
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-294s21c1
Sequence:CCGGAGCAGCCTCGATCCCGTATTTCTCGAGAAATACGGGATCGAGGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1403s21c1
Sequence:CCGGCAGTCTTTGAGGGCAGGATATCTCGAGATATCCTGCCCTCAAAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-400s21c1
Sequence:CCGGCTGATCAACTTTGCCTACAACCTCGAGGTTGTAGGCAAAGTTGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-863s21c1
Sequence:CCGGTGGTGCGTTGCTGCCACAAATCTCGAGATTTGTGGCAGCAACGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025010.4-1364s21c1
Sequence:CCGGTGACCTCGATGAGCTCGAATCCTCGAGGATTCGAGCTCATCGAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-872s1c1
Sequence:CCGGCATCCATCGCTGGACTTATCTCTCGAGAGATAAGTCCAGCGATGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_025010.1-880s1c1
Sequence:CCGGGCTGGACTTATCTACGCTGTACTCGAGTACAGCGTAGATAAGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-618s1c1
Sequence:CCGGGCAGGTCTTTGAAGCTGCATTCTCGAGAATGCAGCTTCAAAGACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025010.1-1137s1c1
Sequence:CCGGGAGAAGGTATTCTGGAAGCCACTCGAGTGGCTTCCAGAATACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-606s1c1
Sequence:CCGGCAAATCTGAGGAGCAGGTCTTCTCGAGAAGACCTGCTCCTCAGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-592s1c1
Sequence:CCGGGATGAGCTGAATGTCAAATCTCTCGAGAGATTTGACATTCAGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025010.1-1122s1c1
Sequence:CCGGGAGCATGAATAGCAAGAGAAGCTCGAGCTTCTCTTGCTATTCATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-723s1c1
Sequence:CCGGCCAGTTCCTTTCAGACAGAATCTCGAGATTCTGTCTGAAAGGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025010.1-729s1c1
Sequence:CCGGCCTTTCAGACAGAATACAGCACTCGAGTGCTGTATTCTGTCTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177771
KLHL18 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-373s1c1
Sequence:CCGGTCTCATCAACTTCGCTTATAACTCGAGTTATAAGCGAAGTTGATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-872s1c1
Sequence:CCGGGATGAAGCAAAGGACTATCATCTCGAGATGATAGTCCTTTGCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177771.3-2440s1c1
Sequence:CCGGCCCAAGAAACAGGAAGGGAATCTCGAGATTCCCTTCCTGTTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-331s1c1
Sequence:CCGGTGAGATTGTAATGCAGGGAATCTCGAGATTCCCTGCATTACAATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-1689s1c1
Sequence:CCGGGAGGTTACGATGGACAGTCAACTCGAGTTGACTGTCCATCGTAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177771
KLHL18 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-373s1c1
Sequence:CCGGTCTCATCAACTTCGCTTATAACTCGAGTTATAAGCGAAGTTGATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-872s1c1
Sequence:CCGGGATGAAGCAAAGGACTATCATCTCGAGATGATAGTCCTTTGCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177771.3-2440s1c1
Sequence:CCGGCCCAAGAAACAGGAAGGGAATCTCGAGATTCCCTTCCTGTTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-331s1c1
Sequence:CCGGTGAGATTGTAATGCAGGGAATCTCGAGATTCCCTGCATTACAATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-1689s1c1
Sequence:CCGGGAGGTTACGATGGACAGTCAACTCGAGTTGACTGTCCATCGTAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177771
KLHL18 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-373s1c1
Sequence:CCGGTCTCATCAACTTCGCTTATAACTCGAGTTATAAGCGAAGTTGATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-872s1c1
Sequence:CCGGGATGAAGCAAAGGACTATCATCTCGAGATGATAGTCCTTTGCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177771.3-2440s1c1
Sequence:CCGGCCCAAGAAACAGGAAGGGAATCTCGAGATTCCCTTCCTGTTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-331s1c1
Sequence:CCGGTGAGATTGTAATGCAGGGAATCTCGAGATTCCCTGCATTACAATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177771.3-1689s1c1
Sequence:CCGGGAGGTTACGATGGACAGTCAACTCGAGTTGACTGTCCATCGTAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)