EMAIL THIS PAGE TO A FRIEND

KLHL1

kelch-like family member 1

115 Gene Product Result for
Synonyms: MRP2
UniProtKB ID: Q9NR64, A8K5X0, Q5VZ64, Q9H4X4, Q9NR65, Q9P238
Gene ID:
Human(57626) Summary: The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]
Mouse(93688) kelch-like 1
Rat(290426) kelch-like family member 1
chicken(418799) kelch-like 1 (Drosophila)
cow(614976) kelch-like 1 (Drosophila)
Horse(100065536) kelch-like 1 (Drosophila)
dog(485487) kelch-like 1 (Drosophila)
domestic guinea pig(100733637) kelch-like family member 1
naked mole-rat(101719465) kelch-like family member 1
sheep(101121433) kelch-like 1 (Drosophila)
Domestic Rabbit(100347488) kelch-like 1 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041911 MISSION® esiRNA esiRNA human KLHL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020866 Rosetta Predictions human pricing
NM_001106054 Rosetta Predictions rat pricing
NM_053105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162976 predicted 2453
2 SASI_Hs01_00162978 predicted 2779
3 SASI_Hs02_00354160 predicted 1708
4 SASI_Hs01_00162979 predicted 2400
5 SASI_Hs01_00162980 predicted 2413
6 SASI_Hs01_00162981 predicted 1431
7 SASI_Hs01_00162982 predicted 2224
8 SASI_Hs01_00162983 predicted 2175
9 SASI_Hs02_00354161 predicted 2620
10 SASI_Hs02_00354162 predicted 2486
11 SASI_Hs01_00162977 predicted 2513
12 SASI_Hs01_00162984 predicted 2747
13 SASI_Hs01_00162985 predicted 2271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215172 predicted 1648
2 SASI_Rn02_00215173 predicted 1266
3 SASI_Rn02_00215174 predicted 2110
4 SASI_Rn02_00215175 predicted 1690
5 SASI_Rn02_00215176 predicted 1626
6 SASI_Rn02_00215177 predicted 1375
7 SASI_Rn02_00215178 predicted 1921
8 SASI_Rn02_00215179 predicted 1806
9 SASI_Rn02_00215180 predicted 1177
10 SASI_Rn02_00215181 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122765 predicted 1739
2 SASI_Mm01_00122766 predicted 2029
3 SASI_Mm02_00337617 predicted 1440
4 SASI_Mm01_00122767 predicted 1657
5 SASI_Mm01_00122769 predicted 2273
6 SASI_Mm01_00122770 predicted 2881
7 SASI_Mm01_00122771 predicted 1365
8 SASI_Mm01_00122772 predicted 1850
9 SASI_Mm01_00122773 predicted 2457
10 SASI_Mm01_00122774 predicted 2565
11 SASI_Mm01_00122768 predicted 2164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020866
KLHL1 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020866.2-2782s21c1
Sequence:CCGGGTTCCCGGCTACTGGATTATGCTCGAGCATAATCCAGTAGCCGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020866.2-3257s21c1
Sequence:CCGGGTTAGTTCGGGAATGGTTATTCTCGAGAATAACCATTCCCGAACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020866.1-3467s1c1
Sequence:CCGGCCTACTAATCAAAGCTGCATACTCGAGTATGCAGCTTTGATTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-2681s1c1
Sequence:CCGGCCTTTGAGTATGCCCAGAGATCTCGAGATCTCTGGGCATACTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1252s1c1
Sequence:CCGGGCAGCAACTTTGTGATGTTATCTCGAGATAACATCACAAAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1850s1c1
Sequence:CCGGCCACAGATATTGGCTGACCTACTCGAGTAGGTCAGCCAATATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1340s1c1
Sequence:CCGGGCGGCCATGTTTACAAGTGATCTCGAGATCACTTGTAAACATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020866
KLHL1 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020866.2-2782s21c1
Sequence:CCGGGTTCCCGGCTACTGGATTATGCTCGAGCATAATCCAGTAGCCGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020866.2-3257s21c1
Sequence:CCGGGTTAGTTCGGGAATGGTTATTCTCGAGAATAACCATTCCCGAACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020866.1-3467s1c1
Sequence:CCGGCCTACTAATCAAAGCTGCATACTCGAGTATGCAGCTTTGATTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-2681s1c1
Sequence:CCGGCCTTTGAGTATGCCCAGAGATCTCGAGATCTCTGGGCATACTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1252s1c1
Sequence:CCGGGCAGCAACTTTGTGATGTTATCTCGAGATAACATCACAAAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1850s1c1
Sequence:CCGGCCACAGATATTGGCTGACCTACTCGAGTAGGTCAGCCAATATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1340s1c1
Sequence:CCGGGCGGCCATGTTTACAAGTGATCTCGAGATCACTTGTAAACATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020866
KLHL1 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020866.2-2782s21c1
Sequence:CCGGGTTCCCGGCTACTGGATTATGCTCGAGCATAATCCAGTAGCCGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020866.2-3257s21c1
Sequence:CCGGGTTAGTTCGGGAATGGTTATTCTCGAGAATAACCATTCCCGAACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020866.1-3467s1c1
Sequence:CCGGCCTACTAATCAAAGCTGCATACTCGAGTATGCAGCTTTGATTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-2681s1c1
Sequence:CCGGCCTTTGAGTATGCCCAGAGATCTCGAGATCTCTGGGCATACTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1252s1c1
Sequence:CCGGGCAGCAACTTTGTGATGTTATCTCGAGATAACATCACAAAGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1850s1c1
Sequence:CCGGCCACAGATATTGGCTGACCTACTCGAGTAGGTCAGCCAATATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020866.1-1340s1c1
Sequence:CCGGGCGGCCATGTTTACAAGTGATCTCGAGATCACTTGTAAACATGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053105
KLHL1 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3309s21c1
Sequence:CCGGCCGCTTGGTTGTTCTCATAATCTCGAGATTATGAGAACAACCAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3188s21c1
Sequence:CCGGTTAGTTCAGGAATGGTTATTGCTCGAGCAATAACCATTCCTGAACTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053105.1-2931s1c1
Sequence:CCGGTCTTTGCTACTGTGGTTATTTCTCGAGAAATAACCACAGTAGCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2708s1c1
Sequence:CCGGCCTTTGAGTATGCCTAGAGATCTCGAGATCTCTAGGCATACTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2490s1c1
Sequence:CCGGCCTGTCTGAGTTCAATGGAATCTCGAGATTCCATTGAACTCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1300s1c1
Sequence:CCGGCCTGATAGTTGGAAATCGAAACTCGAGTTTCGATTTCCAACTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1972s1c1
Sequence:CCGGGCCCGAAAGAAGAACTTTAATCTCGAGATTAAAGTTCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053105
KLHL1 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3309s21c1
Sequence:CCGGCCGCTTGGTTGTTCTCATAATCTCGAGATTATGAGAACAACCAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3188s21c1
Sequence:CCGGTTAGTTCAGGAATGGTTATTGCTCGAGCAATAACCATTCCTGAACTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053105.1-2931s1c1
Sequence:CCGGTCTTTGCTACTGTGGTTATTTCTCGAGAAATAACCACAGTAGCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2708s1c1
Sequence:CCGGCCTTTGAGTATGCCTAGAGATCTCGAGATCTCTAGGCATACTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2490s1c1
Sequence:CCGGCCTGTCTGAGTTCAATGGAATCTCGAGATTCCATTGAACTCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1300s1c1
Sequence:CCGGCCTGATAGTTGGAAATCGAAACTCGAGTTTCGATTTCCAACTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1972s1c1
Sequence:CCGGGCCCGAAAGAAGAACTTTAATCTCGAGATTAAAGTTCTTCTTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053105
KLHL1 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3309s21c1
Sequence:CCGGCCGCTTGGTTGTTCTCATAATCTCGAGATTATGAGAACAACCAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053105.2-3188s21c1
Sequence:CCGGTTAGTTCAGGAATGGTTATTGCTCGAGCAATAACCATTCCTGAACTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053105.1-2931s1c1
Sequence:CCGGTCTTTGCTACTGTGGTTATTTCTCGAGAAATAACCACAGTAGCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2708s1c1
Sequence:CCGGCCTTTGAGTATGCCTAGAGATCTCGAGATCTCTAGGCATACTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-2490s1c1
Sequence:CCGGCCTGTCTGAGTTCAATGGAATCTCGAGATTCCATTGAACTCAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1300s1c1
Sequence:CCGGCCTGATAGTTGGAAATCGAAACTCGAGTTTCGATTTCCAACTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053105.1-1972s1c1
Sequence:CCGGGCCCGAAAGAAGAACTTTAATCTCGAGATTAAAGTTCTTCTTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)