EMAIL THIS PAGE TO A FRIEND

KLHL20

kelch-like family member 20

142 Gene Product Result for
Synonyms: KHLHX KLEIP KLHLX RP3-383J4.3
UniProtKB ID: Q9Y2M5, B3KMA0, Q5TZF2, Q5ZF45, Q9H457
Gene ID:
Human(27252) Summary: The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 44-56 amino acid repeat motif. The kelch motif appears in many different polypeptide contexts and contains multiple potential protein-protein contact sites. Members of this family are present both throughout the cell and extracellularly, with diverse activities. [provided by RefSeq, Jul 2008]
Mouse(226541) kelch-like 20
Rat(304920) kelch-like family member 20
Zebrafish(406274) kelch-like 20 (Drosophila)
chicken(425091) kelch-like 20 (Drosophila)
dog(480067) kelch-like 20 (Drosophila)
cow(511387) kelch-like 20 (Drosophila)
Horse(100060895) kelch-like 20 (Drosophila)
domestic cat(101094229) kelch-like 20 (Drosophila)
domestic guinea pig(100731038) kelch-like family member 20
naked mole-rat(101725550) kelch-like family member 20
sheep(101113256) kelch-like 20 (Drosophila)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014458 Rosetta Predictions human pricing
NM_001107192 Rosetta Predictions rat pricing
NM_001039482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123963 predicted 376
2 SASI_Hs01_00123964 predicted 1976
3 SASI_Hs01_00123965 predicted 549
4 SASI_Hs01_00123966 predicted 1302
5 SASI_Hs02_00345676 predicted 874
6 SASI_Hs01_00123967 predicted 1379
7 SASI_Hs01_00123968 predicted 539
8 SASI_Hs02_00345677 predicted 1986
9 SASI_Hs01_00123969 predicted 497
10 SASI_Hs02_00345678 predicted 327
11 SASI_Hs01_00123962 predicted 1302
12 SASI_Hs01_00123970 predicted 1689
13 SASI_Hs01_00123971 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226415 predicted 1893
2 SASI_Rn02_00226416 predicted 1268
3 SASI_Rn02_00226417 predicted 712
4 SASI_Rn02_00226418 predicted 784
5 SASI_Rn02_00226419 predicted 425
6 SASI_Rn02_00226420 predicted 757
7 SASI_Rn02_00226421 predicted 1959
8 SASI_Rn02_00226422 predicted 1434
9 SASI_Rn02_00226423 predicted 498
10 SASI_Rn02_00226424 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123975 predicted 354
2 SASI_Mm01_00123976 predicted 426
3 SASI_Mm01_00123977 predicted 1961
4 SASI_Mm01_00123978 predicted 1433
5 SASI_Mm01_00123979 predicted 1050
6 SASI_Mm01_00123980 predicted 370
7 SASI_Mm01_00123981 predicted 1280
8 SASI_Mm02_00290070 predicted 1487
9 SASI_Mm01_00123982 predicted 789
10 SASI_Mm01_00123983 predicted 1084
11 SASI_Mm01_00123984 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014458
VALIDATED
KLHL20 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-415s21c1
Sequence:CCGGTATATGCCCATCGAGTCATTTCTCGAGAAATGACTCGATGGGCATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1984s21c1
Sequence:CCGGCACATTGTGAATCCCATATTTCTCGAGAAATATGGGATTCACAATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1067s21c1
Sequence:CCGGGCCGCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014458.3-1911s21c1
Sequence:CCGGGCCAATACATGGAGGTTATATCTCGAGATATAACCTCCATGTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014458.3-2456s21c1
Sequence:CCGGATGTATTAGCTACCCATTATTCTCGAGAATAATGGGTAGCTAATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014458.3-3001s1c1
Sequence:CCGGGCACACATTAAAGAGTGTAAACTCGAGTTTACACTCTTTAATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-1457s1c1
Sequence:CCGGCCTCAACATTGTTGAGAGGTACTCGAGTACCTCTCAACAATGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-810s1c1
Sequence:CCGGGCCAATCAACTCATTGATATACTCGAGTATATCAATGAGTTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-956s1c1
Sequence:CCGGGCCTTTGCTTAGTCCCAAGTTCTCGAGAACTTGGGACTAAGCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-807s1c1
Sequence:CCGGCCAGCCAATCAACTCATTGATCTCGAGATCAATGAGTTGATTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014458
VALIDATED
KLHL20 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-415s21c1
Sequence:CCGGTATATGCCCATCGAGTCATTTCTCGAGAAATGACTCGATGGGCATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1984s21c1
Sequence:CCGGCACATTGTGAATCCCATATTTCTCGAGAAATATGGGATTCACAATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1067s21c1
Sequence:CCGGGCCGCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014458.3-1911s21c1
Sequence:CCGGGCCAATACATGGAGGTTATATCTCGAGATATAACCTCCATGTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014458.3-2456s21c1
Sequence:CCGGATGTATTAGCTACCCATTATTCTCGAGAATAATGGGTAGCTAATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014458.3-3001s1c1
Sequence:CCGGGCACACATTAAAGAGTGTAAACTCGAGTTTACACTCTTTAATGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-1457s1c1
Sequence:CCGGCCTCAACATTGTTGAGAGGTACTCGAGTACCTCTCAACAATGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-810s1c1
Sequence:CCGGGCCAATCAACTCATTGATATACTCGAGTATATCAATGAGTTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-956s1c1
Sequence:CCGGGCCTTTGCTTAGTCCCAAGTTCTCGAGAACTTGGGACTAAGCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-807s1c1
Sequence:CCGGCCAGCCAATCAACTCATTGATCTCGAGATCAATGAGTTGATTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014458
VALIDATED
KLHL20 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-415s21c1
Sequence:CCGGTATATGCCCATCGAGTCATTTCTCGAGAAATGACTCGATGGGCATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1984s21c1
Sequence:CCGGCACATTGTGAATCCCATATTTCTCGAGAAATATGGGATTCACAATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014458.3-1067s21c1
Sequence:CCGGGCCGCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014458.3-1911s21c1
Sequence:CCGGGCCAATACATGGAGGTTATATCTCGAGATATAACCTCCATGTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014458.3-2456s21c1
Sequence:CCGGATGTATTAGCTACCCATTATTCTCGAGAATAATGGGTAGCTAATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014458.3-3001s1c1
Sequence:CCGGGCACACATTAAAGAGTGTAAACTCGAGTTTACACTCTTTAATGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-1457s1c1
Sequence:CCGGCCTCAACATTGTTGAGAGGTACTCGAGTACCTCTCAACAATGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-810s1c1
Sequence:CCGGGCCAATCAACTCATTGATATACTCGAGTATATCAATGAGTTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-956s1c1
Sequence:CCGGGCCTTTGCTTAGTCCCAAGTTCTCGAGAACTTGGGACTAAGCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014458.3-807s1c1
Sequence:CCGGCCAGCCAATCAACTCATTGATCTCGAGATCAATGAGTTGATTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144876
VALIDATED
KLHL20 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-2784s1c1
Sequence:CCGGCCACTGTTACTCTGTCCCTATCTCGAGATAGGGACAGAGTAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-996s1c1
Sequence:CCGGGCCTCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-469s1c1
Sequence:CCGGCTCCTGATTGACTTTGCATATCTCGAGATATGCAAAGTCAATCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-995s1c1
Sequence:CCGGTGCCTCAAGAACGACCACTAACTCGAGTTAGTGGTCGTTCTTGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-817s1c1
Sequence:CCGGGCCTGGGTCAAATACAGTATTCTCGAGAATACTGTATTTGACCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144876
VALIDATED
KLHL20 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-2784s1c1
Sequence:CCGGCCACTGTTACTCTGTCCCTATCTCGAGATAGGGACAGAGTAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-996s1c1
Sequence:CCGGGCCTCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-469s1c1
Sequence:CCGGCTCCTGATTGACTTTGCATATCTCGAGATATGCAAAGTCAATCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-995s1c1
Sequence:CCGGTGCCTCAAGAACGACCACTAACTCGAGTTAGTGGTCGTTCTTGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-817s1c1
Sequence:CCGGGCCTGGGTCAAATACAGTATTCTCGAGAATACTGTATTTGACCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144876
VALIDATED
KLHL20 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-2784s1c1
Sequence:CCGGCCACTGTTACTCTGTCCCTATCTCGAGATAGGGACAGAGTAACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-996s1c1
Sequence:CCGGGCCTCAAGAACGACCACTAATCTCGAGATTAGTGGTCGTTCTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-469s1c1
Sequence:CCGGCTCCTGATTGACTTTGCATATCTCGAGATATGCAAAGTCAATCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-995s1c1
Sequence:CCGGTGCCTCAAGAACGACCACTAACTCGAGTTAGTGGTCGTTCTTGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144876.2-817s1c1
Sequence:CCGGGCCTGGGTCAAATACAGTATTCTCGAGAATACTGTATTTGACCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)