EMAIL THIS PAGE TO A FRIEND

KLHL21

kelch-like family member 21

52 Gene Product Result for
Gene ID:
Mouse(242785) kelch-like 21
Rat(313743) kelch-like family member 21
sheep(101120765) kelch-like 21 (Drosophila)
domestic guinea pig(100723736) kelch-like family member 21
naked mole-rat(101700622) kelch-like family member 21
Zebrafish(404613) kelch-like 21 (Drosophila)
cow(506632) kelch-like 21 (Drosophila)
domestic cat(101094864) kelch-like 21 (Drosophila)
dog(489634) kelch-like 21 (Drosophila)
chicken(428175) kelch-like 21 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033352 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033352 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033352 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014851 Rosetta Predictions human pricing
NM_001107996 Rosetta Predictions rat pricing
NM_001033352 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183012 predicted 1450
2 SASI_Hs01_00183013 predicted 2145
3 SASI_Hs01_00183014 predicted 1461
4 SASI_Hs02_00346416 predicted 2152
5 SASI_Hs01_00183016 predicted 1101
6 SASI_Hs02_00346417 predicted 1534
7 SASI_Hs01_00183017 predicted 1771
8 SASI_Hs01_00183018 predicted 1743
9 SASI_Hs01_00183019 predicted 1522
10 SASI_Hs02_00346418 predicted 1451
11 SASI_Hs01_00183010 predicted 1992
12 SASI_Hs01_00183011 predicted 1227
13 SASI_Hs01_00183015 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234335 predicted 1470
2 SASI_Rn02_00234336 predicted 975
3 SASI_Rn02_00234337 predicted 1395
4 SASI_Rn02_00234338 predicted 683
5 SASI_Rn02_00234339 predicted 1116
6 SASI_Rn02_00234340 predicted 1953
7 SASI_Rn02_00234341 predicted 1966
8 SASI_Rn02_00234342 predicted 1334
9 SASI_Rn02_00234343 predicted 1664
10 SASI_Rn02_00234344 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032035 predicted 1448
2 SASI_Mm01_00032036 predicted 2007
3 SASI_Mm01_00032038 predicted 1525
4 SASI_Mm02_00288649 predicted 2006
5 SASI_Mm01_00032039 predicted 1456
6 SASI_Mm01_00032040 predicted 1949
7 SASI_Mm01_00032041 predicted 1366
8 SASI_Mm01_00032042 predicted 1092
9 SASI_Mm01_00032043 predicted 1929
10 SASI_Mm02_00288650 predicted 1124
11 SASI_Mm01_00032034 predicted 1934
12 SASI_Mm01_00032037 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033352
VALIDATED
KLHL21 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1347s21c1
Sequence:CCGGGCAAGGAGACCATGGTGATACCTCGAGGTATCACCATGGTCTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-957s21c1
Sequence:CCGGTTACGGTCGACTGCTACAATCCTCGAGGATTGTAGCAGTCGACCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1530s21c1
Sequence:CCGGACAAGATCCCATCCATGAATCCTCGAGGATTCATGGATGGGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-3688s21c1
Sequence:CCGGTGTGCCTAGTATTGATCTATACTCGAGTATAGATCAATACTAGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-1101s21c1
Sequence:CCGGACTGCGTGTGGAGATACAATTCTCGAGAATTGTATCTCCACACGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033352
VALIDATED
KLHL21 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1347s21c1
Sequence:CCGGGCAAGGAGACCATGGTGATACCTCGAGGTATCACCATGGTCTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-957s21c1
Sequence:CCGGTTACGGTCGACTGCTACAATCCTCGAGGATTGTAGCAGTCGACCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1530s21c1
Sequence:CCGGACAAGATCCCATCCATGAATCCTCGAGGATTCATGGATGGGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-3688s21c1
Sequence:CCGGTGTGCCTAGTATTGATCTATACTCGAGTATAGATCAATACTAGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-1101s21c1
Sequence:CCGGACTGCGTGTGGAGATACAATTCTCGAGAATTGTATCTCCACACGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033352
VALIDATED
KLHL21 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1347s21c1
Sequence:CCGGGCAAGGAGACCATGGTGATACCTCGAGGTATCACCATGGTCTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-957s21c1
Sequence:CCGGTTACGGTCGACTGCTACAATCCTCGAGGATTGTAGCAGTCGACCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033352.3-1530s21c1
Sequence:CCGGACAAGATCCCATCCATGAATCCTCGAGGATTCATGGATGGGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-3688s21c1
Sequence:CCGGTGTGCCTAGTATTGATCTATACTCGAGTATAGATCAATACTAGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033352.3-1101s21c1
Sequence:CCGGACTGCGTGTGGAGATACAATTCTCGAGAATTGTATCTCCACACGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014851
KLHL21 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 21
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1529s1c1
Sequence:CCGGGACAAGATCCCGTCCATGAATCTCGAGATTCATGGACGGGATCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1516s1c1
Sequence:CCGGGAGGAACGAATGGGACAAGATCTCGAGATCTTGTCCCATTCGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1465s1c1
Sequence:CCGGCATGTACTTTGTCAGGGATGACTCGAGTCATCCCTGACAAAGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1454s1c1
Sequence:CCGGCTAAACGGACTCATGTACTTTCTCGAGAAAGTACATGAGTCCGTTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-952s1c1
Sequence:CCGGGCTGGTCACTGTCGACTGCTACTCGAGTAGCAGTCGACAGTGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1111s1c1
Sequence:CCGGGAGGTACAACTCAAGCGTGAACTCGAGTTCACGCTTGAGTTGTACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014851
KLHL21 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 21
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1529s1c1
Sequence:CCGGGACAAGATCCCGTCCATGAATCTCGAGATTCATGGACGGGATCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1516s1c1
Sequence:CCGGGAGGAACGAATGGGACAAGATCTCGAGATCTTGTCCCATTCGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1465s1c1
Sequence:CCGGCATGTACTTTGTCAGGGATGACTCGAGTCATCCCTGACAAAGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1454s1c1
Sequence:CCGGCTAAACGGACTCATGTACTTTCTCGAGAAAGTACATGAGTCCGTTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-952s1c1
Sequence:CCGGGCTGGTCACTGTCGACTGCTACTCGAGTAGCAGTCGACAGTGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1111s1c1
Sequence:CCGGGAGGTACAACTCAAGCGTGAACTCGAGTTCACGCTTGAGTTGTACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014851
KLHL21 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 21
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1529s1c1
Sequence:CCGGGACAAGATCCCGTCCATGAATCTCGAGATTCATGGACGGGATCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1516s1c1
Sequence:CCGGGAGGAACGAATGGGACAAGATCTCGAGATCTTGTCCCATTCGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1465s1c1
Sequence:CCGGCATGTACTTTGTCAGGGATGACTCGAGTCATCCCTGACAAAGTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1454s1c1
Sequence:CCGGCTAAACGGACTCATGTACTTTCTCGAGAAAGTACATGAGTCCGTTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-952s1c1
Sequence:CCGGGCTGGTCACTGTCGACTGCTACTCGAGTAGCAGTCGACAGTGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014851.2-1111s1c1
Sequence:CCGGGAGGTACAACTCAAGCGTGAACTCGAGTTCACGCTTGAGTTGTACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)