EMAIL THIS PAGE TO A FRIEND

KLHL22

kelch-like family member 22

54 Gene Product Result for
Synonyms: KELCHL
UniProtKB ID: Q53GT1, A8K3Q4, A8MTV3, D3DX30, Q96B68, Q96KC6
Gene ID:
Mouse(224023) kelch-like 22
Rat(303792) kelch-like family member 22
Zebrafish(100270738) kelch-like 22 (Drosophila)
domestic cat(101099662) kelch-like 22 (Drosophila)
cow(540134) kelch-like 22 (Drosophila)
Horse(100049928) kelch-like 22 (Drosophila)
dog(486433) kelch-like 22 (Drosophila)
chicken(416940) kelch-like 22 (Drosophila)
domestic guinea pig(100725427) kelch-like family member 22
naked mole-rat(101697152) kelch-like family member 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032775 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032775 Rosetta Predictions human pricing
NM_001107079 Rosetta Predictions rat pricing
NM_145479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149494 predicted 1947
2 SASI_Hs02_00360312 predicted 1470
3 SASI_Hs01_00149496 predicted 666
4 SASI_Hs01_00149497 predicted 674
5 SASI_Hs01_00149498 predicted 1322
6 SASI_Hs01_00149499 predicted 1605
7 SASI_Hs01_00149500 predicted 1396
8 SASI_Hs01_00149501 predicted 1477
9 SASI_Hs01_00149502 predicted 411
10 SASI_Hs01_00149503 predicted 1283
11 SASI_Hs01_00149495 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225286 predicted 1184
2 SASI_Rn02_00225287 predicted 237
3 SASI_Rn02_00225288 predicted 380
4 SASI_Rn02_00225289 predicted 1550
5 SASI_Rn02_00225290 predicted 2013
6 SASI_Rn02_00225291 predicted 1564
7 SASI_Rn02_00225292 predicted 510
8 SASI_Rn02_00225293 predicted 1437
9 SASI_Rn02_00225294 predicted 1280
10 SASI_Rn02_00225295 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199597 predicted 405
2 SASI_Mm01_00199598 predicted 439
3 SASI_Mm01_00199599 predicted 521
4 SASI_Mm01_00199600 predicted 299
5 SASI_Mm02_00340882 predicted 2113
6 SASI_Mm01_00199601 predicted 327
7 SASI_Mm01_00199602 predicted 1607
8 SASI_Mm01_00199603 predicted 387
9 SASI_Mm01_00199604 predicted 1068
10 SASI_Mm02_00340883 predicted 623
11 SASI_Mm01_00199605 predicted 1070
12 SASI_Mm01_00199606 predicted 1817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145479
VALIDATED
KLHL22 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 22
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-325s21c1
Sequence:CCGGTAGCTGCATCGTGTGATTATTCTCGAGAATAATCACACGATGCAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145479.4-2284s1c1
Sequence:CCGGCTGAATGAGTGGGATCTATTTCTCGAGAAATAGATCCCACTCATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-2285s21c1
Sequence:CCGGTGAATGAGTGGGATCTATTTGCTCGAGCAAATAGATCCCACTCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-626s21c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-427s21c1
Sequence:CCGGGCCAAATCCTGCACTTCATATCTCGAGATATGAAGTGCAGGATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-1163s21c1
Sequence:CCGGCAACAACTTCGTGTACTTAATCTCGAGATTAAGTACACGAAGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-2310s1c1
Sequence:CCGGGCACATCTACGACATGGAGAACTCGAGTTCTCCATGTCGTAGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1060s1c1
Sequence:CCGGGTAGATGAGGAGAATATCCTTCTCGAGAAGGATATTCTCCTCATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1659s1c1
Sequence:CCGGGCTCAACAACTTCGTGTACTTCTCGAGAAGTACACGAAGTTGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1789s1c1
Sequence:CCGGGCAGACCTATGTGTGTGTGTACTCGAGTACACACACACATAGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1633s1c1
Sequence:CCGGCGAATGTCCAATCAGGGCATTCTCGAGAATGCCCTGATTGGACATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145479.2-1014s1c1
Sequence:CCGGGATACCAGAAATTATCCACTTCTCGAGAAGTGGATAATTTCTGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1125s1c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145479
VALIDATED
KLHL22 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 22
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-325s21c1
Sequence:CCGGTAGCTGCATCGTGTGATTATTCTCGAGAATAATCACACGATGCAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145479.4-2284s1c1
Sequence:CCGGCTGAATGAGTGGGATCTATTTCTCGAGAAATAGATCCCACTCATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-2285s21c1
Sequence:CCGGTGAATGAGTGGGATCTATTTGCTCGAGCAAATAGATCCCACTCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-626s21c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-427s21c1
Sequence:CCGGGCCAAATCCTGCACTTCATATCTCGAGATATGAAGTGCAGGATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-1163s21c1
Sequence:CCGGCAACAACTTCGTGTACTTAATCTCGAGATTAAGTACACGAAGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-2310s1c1
Sequence:CCGGGCACATCTACGACATGGAGAACTCGAGTTCTCCATGTCGTAGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1060s1c1
Sequence:CCGGGTAGATGAGGAGAATATCCTTCTCGAGAAGGATATTCTCCTCATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1659s1c1
Sequence:CCGGGCTCAACAACTTCGTGTACTTCTCGAGAAGTACACGAAGTTGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1789s1c1
Sequence:CCGGGCAGACCTATGTGTGTGTGTACTCGAGTACACACACACATAGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1633s1c1
Sequence:CCGGCGAATGTCCAATCAGGGCATTCTCGAGAATGCCCTGATTGGACATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145479.2-1014s1c1
Sequence:CCGGGATACCAGAAATTATCCACTTCTCGAGAAGTGGATAATTTCTGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1125s1c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145479
VALIDATED
KLHL22 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 22
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-325s21c1
Sequence:CCGGTAGCTGCATCGTGTGATTATTCTCGAGAATAATCACACGATGCAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145479.4-2284s1c1
Sequence:CCGGCTGAATGAGTGGGATCTATTTCTCGAGAAATAGATCCCACTCATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-2285s21c1
Sequence:CCGGTGAATGAGTGGGATCTATTTGCTCGAGCAAATAGATCCCACTCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-626s21c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-427s21c1
Sequence:CCGGGCCAAATCCTGCACTTCATATCTCGAGATATGAAGTGCAGGATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145479.4-1163s21c1
Sequence:CCGGCAACAACTTCGTGTACTTAATCTCGAGATTAAGTACACGAAGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-2310s1c1
Sequence:CCGGGCACATCTACGACATGGAGAACTCGAGTTCTCCATGTCGTAGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1060s1c1
Sequence:CCGGGTAGATGAGGAGAATATCCTTCTCGAGAAGGATATTCTCCTCATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145479.2-1659s1c1
Sequence:CCGGGCTCAACAACTTCGTGTACTTCTCGAGAAGTACACGAAGTTGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1789s1c1
Sequence:CCGGGCAGACCTATGTGTGTGTGTACTCGAGTACACACACACATAGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1633s1c1
Sequence:CCGGCGAATGTCCAATCAGGGCATTCTCGAGAATGCCCTGATTGGACATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145479.2-1014s1c1
Sequence:CCGGGATACCAGAAATTATCCACTTCTCGAGAAGTGGATAATTTCTGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145479.2-1125s1c1
Sequence:CCGGCCAACAGCTAGATACCTACATCTCGAGATGTAGGTATCTAGCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032775
VALIDATED
KLHL22 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-613s21c1
Sequence:CCGGTGAGCAACTGGACACCTATATCTCGAGATATAGGTGTCCAGTTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032775.2-2203s21c1
Sequence:CCGGAGATCCCAGGCTGTGGATTACCTCGAGGTAATCCACAGCCTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1332s21c1
Sequence:CCGGACTACCACAATGACCTGAATGCTCGAGCATTCAGGTCATTGTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1054s21c1
Sequence:CCGGCGACCAGGCCAAGTATCTAAACTCGAGTTTAGATACTTGGCCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-756s21c1
Sequence:CCGGGGGCCCTTCTCTACCATTATACTCGAGTATAATGGTAGAGAAGGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1143s1c1
Sequence:CCGGCGGTGCTCAACAACTTCGTATCTCGAGATACGAAGTTGTTGAGCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-502s1c1
Sequence:CCGGGATCCCAGAAATTATCCATTTCTCGAGAAATGGATAATTTCTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-400s1c1
Sequence:CCGGCTACAATGCTATGTGCCAAATCTCGAGATTTGGCACATAGCATTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1582s1c1
Sequence:CCGGCCTCAACAAGCTGTATGTGATCTCGAGATCACATACAGCTTGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032775
VALIDATED
KLHL22 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-613s21c1
Sequence:CCGGTGAGCAACTGGACACCTATATCTCGAGATATAGGTGTCCAGTTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032775.2-2203s21c1
Sequence:CCGGAGATCCCAGGCTGTGGATTACCTCGAGGTAATCCACAGCCTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1332s21c1
Sequence:CCGGACTACCACAATGACCTGAATGCTCGAGCATTCAGGTCATTGTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1054s21c1
Sequence:CCGGCGACCAGGCCAAGTATCTAAACTCGAGTTTAGATACTTGGCCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-756s21c1
Sequence:CCGGGGGCCCTTCTCTACCATTATACTCGAGTATAATGGTAGAGAAGGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1143s1c1
Sequence:CCGGCGGTGCTCAACAACTTCGTATCTCGAGATACGAAGTTGTTGAGCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-502s1c1
Sequence:CCGGGATCCCAGAAATTATCCATTTCTCGAGAAATGGATAATTTCTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-400s1c1
Sequence:CCGGCTACAATGCTATGTGCCAAATCTCGAGATTTGGCACATAGCATTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1582s1c1
Sequence:CCGGCCTCAACAAGCTGTATGTGATCTCGAGATCACATACAGCTTGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032775
VALIDATED
KLHL22 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-613s21c1
Sequence:CCGGTGAGCAACTGGACACCTATATCTCGAGATATAGGTGTCCAGTTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032775.2-2203s21c1
Sequence:CCGGAGATCCCAGGCTGTGGATTACCTCGAGGTAATCCACAGCCTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1332s21c1
Sequence:CCGGACTACCACAATGACCTGAATGCTCGAGCATTCAGGTCATTGTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-1054s21c1
Sequence:CCGGCGACCAGGCCAAGTATCTAAACTCGAGTTTAGATACTTGGCCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032775.2-756s21c1
Sequence:CCGGGGGCCCTTCTCTACCATTATACTCGAGTATAATGGTAGAGAAGGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1143s1c1
Sequence:CCGGCGGTGCTCAACAACTTCGTATCTCGAGATACGAAGTTGTTGAGCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-502s1c1
Sequence:CCGGGATCCCAGAAATTATCCATTTCTCGAGAAATGGATAATTTCTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-400s1c1
Sequence:CCGGCTACAATGCTATGTGCCAAATCTCGAGATTTGGCACATAGCATTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032775.2-1582s1c1
Sequence:CCGGCCTCAACAAGCTGTATGTGATCTCGAGATCACATACAGCTTGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)